How to find a randomly placed numerical value after a string match - python

I have a text file as follows:
GROSS WE GHT
MARKS AND NUMBERS:
PCS:
(KILO):
POW- 40162463
PAF. 128993.1
BOM
1 USTER QUANTUM 3
1.10
VIA MUMBAI
AIRPORT/INDIA
CO210044158
Here the output I want is using regex and python print "weight= 1.10 Kilos".
import re
with open('file_new1.txt') as fd:
for line in fd:
match = re.search(r'KILO', line)
if match:
print('found')
I have made the following code to match KILO in the above text file. My question is How do I match the numeric 1.10 after I find string 'KILO'? Please note :
1) 1.10 is sample weight it can also have value of 2322.00 or other integer value
2) 1.10 always occurs after KILO and on a new line
3) String can have value of KILO or KG

The below loops through the file until it sees a line containing KILO or KG. It tries to convert every line after that one to a float, and returns that float when successful
def get_weight(fp):
next(line for line in fp if 'KILO' in line or 'KG' in line)
for line in fp:
try:
return float(line)
except ValueError:
continue
raise ValueError("No numeric line after 'KILO'")
with open('file_new1.txt') as fd:
print(get_weight(fd))
# 1.1
The search for KILO or KG is pretty basic, and prone to false positives. If you know it will always appear with other characteristics (Surrounded by parentheses, for example), you may want to include those in the search.

Related

Parsing numbers in strings from a file

I have a txt file as here:
pid,party,state,res
SC5,Republican,NY,Donald Trump 45%-Marco Rubio 18%-John Kasich 18%-Ted Cruz 11%
TB1,Republican,AR,Ted Cruz 27%-Marco Rubio 23%-Donald Trump 23%-Ben Carson 11%
FX2,Democratic,MI,Hillary Clinton 61%-Bernie Sanders 34%
BN1,Democratic,FL,Hillary Clinton 61%-Bernie Sanders 30%
PB2,Democratic,OH,Hillary Clinton 56%-Bernie Sanders 35%
what I want to do, is check that the % of each "res" gets to 100%
def addPoll(pid,party,state,res,filetype):
with open('Polls.txt', 'a+') as file: # open file temporarly for writing and reading
lines = file.readlines() # get all lines from file
file.seek(0)
next(file) # go to next line --
#this is suppose to skip the 1st line with pid/pary/state/res
for line in lines: # loop
line = line.split(',', 3)[3]
y = line.split()
print y
#else:
#file.write(pid + "," + party + "," + state + "," + res+"\n")
#file.close()
return "pass"
print addPoll("123","Democratic","OH","bla bla 50%-Asd ASD 50%",'f')
So in my code I manage to split the last ',' and enter it into a list, but im not sure how I can get only the numbers out of that text.
You can use regex to find all the numbers:
import re
for line in lines:
numbers = re.findall(r'\d+', line)
numbers = [int(n) for n in numbers]
print(sum(numbers))
This will print
0 # no numbers in the first line
97
85
97
92
93
The re.findall() method finds all substrings matching the specified pattern, which in this case is \d+, meaning any continuous string of digits. This returns a list of strings, which we cast to a list of ints, then take the sum.
It seems like what you have is CSV. Instead of trying to parse that on your own, Python already has a builtin parser that will give you back nice dictionaries (so you can do line['res']):
import csv
with open('Polls.txt') as f:
reader = csv.DictReader(f)
for row in reader:
# Do something with row['res']
pass
For the # Do something part, you can either parse the field manually (it appears to be structured): split('-') and then rsplit(' ', 1) each - separated part (the last thing should be the percent). If you're trying to enforce a format, then I'd definitely go this route, but regex are also a fine solution too for quickly pulling out what you want. You'll want to read up on them, but in your case, you want \d+%:
# Manually parse (throws IndexError if there isn't a space separating candidate name and %)
percents = [candidate.rsplit(' ', 1)[1] for candidate row['res'].split('-')]
if not all(p.endswith('%') for p in percents):
# Handle bad percent (not ending in %)
pass
else:
# Throws ValueError if any of the percents aren't integers
percents = [int(p[:-1]) for p in percents]
if sum(percents) != 100:
# Handle bad total
pass
Or with regex:
percents = [int(match.group(1)) for match in re.finditer(r'(\d+)%', row['res'])]
if sum(percents) != 100:
# Handle bad total here
pass
Regex is certainly shorter, but the former will enforce more strict formatting requirements on row['res'] and will allow you to later extract things like candidate names.
Also some random notes:
You don't need to open with 'a+' unless you plan to append to the file, 'r' will do (and 'r' is implicit, so you don't have to specify it).
Instead of next() use a for loop!

stripping the correct float value out of my string

I am using python to process pcap files and input the processed values to a text file. The text file has around 8000 rows and some times, the text file has string such as 7.70.582 . In my further processing of the text file i am splitting the file into lines and extracting each of the float values in every line. Then I get this error
ValueError: invalid literal for float(): 7.70.582
In such cases I am interested only in 7.70 and I need to avoid everything after the second decimal including it. Is there any trick to extract only the string till the first character after the first decimal point?
I was searching for an answer for this and it seems there has been no such situation asked before.
Or is there a method where I can skip those lines where this kind of errors are happening?
I'm not a huge fan of this approach, but the simplest might be something like:
strs = [
"7",
"7.70",
"7.70.582",
"7.70.582.123"
]
def parse(s):
s += ".."
return float(s[:s.index(".", s.index(".")+1)])
for s in strs:
print(s, parse(s))
It's a more legible approach might be to use something like:
def parse(s):
if s.count('.') <= 1: return float(s)
return float(s[:s.index(".", s.index(".")+1)])
Or, based off Ajax1234's answer:
def parse(s):
return float('.'.join(s.split('.')[:2]))
All versions output:
7 7.0
7.70 7.7
7.70.582 7.7
7.70.582.123 7.7
You can use a regular expression, like this one:
https://pythex.org/?regex=%5E(%5B0-9%5D%2B%5C.%5B0-9%5D%2B).*&test_string=7.70.582&ignorecase=0&multiline=0&dotall=0&verbose=0
If your line is like '7.70.582' this regex will extract the 7.70 into the first group:
^([0-9]+.[0-9]+).*
https://docs.python.org/2/library/re.html
import re
line = "7654 16.317 8.651 7.70.582 17.487"
val = line.split(" ")[3]
m = re.search('^([0-9]+\.[0-9]+).*', val)
m.group(1)
'7.70'
float(m.group(1))
7.70
You can use str.split() and '.'.join:
s = "7654 16.317 8.651 7.70.582 17.487"
final_data = map(float, ['.'.join(i.split('.')[:-1]) if len(i.split('.')) > 2 else i for i in s.split()])
Output:
[7654.0, 16.317, 8.651, 7.7, 17.487]
Regarding the single string:
s = ["7.70.582"]
final_data = map(float, ['.'.join(i.split('.')[:-1]) if len(i.split('.')) > 2 else i for i in s])
Output:
[7.7]

regular expressions in python using quotes

I am attempting to create a regular expression pattern for strings similar to the below which are stored in a file. The aim is to get any column for any row, the rows need not be on a single line. So for example, consider the following file:
"column1a","column2a","column
3a,", #entity 1
"column\"this is, a test\"4a"
"column1b","colu
mn2b,","column3b", #entity 2
"column\"this is, a test\"4b"
"column1c,","column2c","column3c", #entity 3
"column\"this is, a test\"4c"
Each entity consists of four columns, column 4 for entity 2 would be "column\"this is, a test\"4b", column 2 for entity 3 would be "column2c". Each column begins with a quote and closes with a quote, however you must be careful because some columns have escaped quotes. Thanks in advance!
You could do like this, ie
Read the whole file.
Split the input according to the newline character which was not preceded by a comma.
Iterate over the spitted elements and again do splitting on the comma (and also the following optional newline character) which was preceded and followed by double quotes.
Code:
import re
with open(file) as f:
fil = f.read()
m = re.split(r'(?<!,)\n', fil.strip())
for i in m:
print(re.split('(?<="),\n?(?=")', i))
Output:
['"column1a"', '"column2a"', '"column3a,"', '"column\\"this is, a test\\"4a"']
['"column1b"', '"column2b,"', '"column3b"', '"column\\"this is, a test\\"4b"']
['"column1c,"', '"column2c"', '"column3c"', '"column\\"this is, a test\\"4c"']
Here is the check..
$ cat f
"column1a","column2a","column3a,",
"column\"this is, a test\"4a"
"column1b","column2b,","column3b",
"column\"this is, a test\"4b"
"column1c,","column2c","column3c",
"column\"this is, a test\"4c"
$ python3 f.py
['"column1a"', '"column2a"', '"column3a,"', '"column\\"this is, a test\\"4a"']
['"column1b"', '"column2b,"', '"column3b"', '"column\\"this is, a test\\"4b"']
['"column1c,"', '"column2c"', '"column3c"', '"column\\"this is, a test\\"4c"']
f is the input file name and f.py is the file-name which contains the python script.
Your problem is terribly familiar to what I have to deal thrice every month :) Except I'm not using python to solve it, but I can 'translate' what I usually do:
text = r'''"column1a","column2a","column
3a,",
"column\"this is, a test\"4a"
"column1a2","column2a2","column3a2","column4a2"
"column1b","colu
mn2b,","column3b",
"column\"this is, a test\"4b"
"column1c,","column2c","column3c",
"column\"this is, a test\"4c"'''
import re
# Number of columns one line is supposed to have
columns = 4
# Temporary variable to hold partial lines
buffer = ""
# Our regex to check for each column
check = re.compile(r'"(?:[^"\\]*|\\.)*"')
# Read the file line by line
for line in text.split("\n"):
# If there's no stored partial line, this is a new line
if buffer == "":
# Check if we get 4 columns and print, if not, put the line
# into buffer so we store a partial line for later
if len(check.findall(line)) == columns:
print matches
else:
# use line.strip() if you need to trim whitespaces
buffer = line
else:
# Update the variable (containing a partial line) with the
# next line and recheck if we get 4 columns
# use line.strip() if you need to trim whitespaces
buffer = buffer + line
# If we indeed get 4, our line is complete and print
# We must not forget to empty buffer now that we got a whole line
if len(check.findall(buffer)) == columns:
print matches
buffer = ""
# Optional; always good to have a safety backdoor though
# If there is a problem with the csv itself like a weird unescaped
# quote, you send it somewhere else
elif len(check.findall(buffer)) > columns:
print "Error: cannot parse line:\n" + buffer
buffer = ""
ideone demo

Fastq parser not taking empty sequence (and other edge cases). Python

this is a continuation of Generator not working to split string by particular identifier . Python 2 . however, i modified the code completely and it's not the same format at all. this is about edge cases
Edge Cases:
. when sequence length is different than number of quality values
. when there's an empty sequence or entry
. when the number of lines with quality values is more than one
i cannot figure out how to work with the edge cases above. If its an empty data file, then I still want to output empty strings. i'm trying with these sequences right here for my input file: (Just a little background, IDs are set by # at beginning of line, sequence characters are followed by the lines after until a line with + is reached. the next lines are going to have quality values (value ~= chr(char) ) this format is terrible and poorly thought out.
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs
CTCTCTCATCACACACGAGGAGTGAAGAGAGAACCTCCTCTCCACACGTGGAGTGAGGAGATCCTCTCACACACGTGAGGTGTTGAGAGAGATACTCTCTCATCACCTCACGTGAGGAGTGAGAGAGAT
+
{~~~~~sXNL>>||~~fVM~jtu~&&(uxy~f8YHh=<gA5
''<O1A44N'`oK57(((G&&Q*Q66;"$$Df66E~Z\ZMO>^;%L}~~~~~Q.~~~~x~#-LF9>~MMqbV~ABBV=99mhIwGRR~
#different_number_of_seq_qual
ATCG
+
**!
#this_should_work
GGGG
+
****
The ones with an error, I'm trying to replace the seq and qual strings with empty strings
seq,qual = '',''
Here's my code so far. These edge cases are so difficult for me to figure out please help . . .
def read_fastq(input, offset):
"""
Inputs a fastq file and reads each line at a time. 'offset' parameter can be set to 33 (phred+33 encoding
fastq), and 64. Yields a tuple in the format (ID, comments for a sequence, sequence, [integer quality values])
Capable of reading empty sequences and empty files.
"""
ID, comment, seq, qual = None,'','',''
step = 1 #step is a variable that organizes the order fastq parsing
#step= 1 scans for ID and comment line
#step= 2 adds relevant lines to sequence string
#step= 3 adds quality values to string
for line in input:
line = line.strip()
if step == 1 and line.startswith('#'): #Step system from Nedda Saremi
if ID is not None:
qual = [ord(char)-offset for char in qual] #Converts from phred encoding to integer values
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1) #Separates ID and comment by ' '
yield ID, comment, seq, qual
ID,comment,seq,qual = None,'','','' #Resets variable for next sequence
ID = line[1:]
step = 2
continue
if step==2 and not line.startswith('#') and not line.startswith('+'):
seq = seq + line.strip()
continue
if step == 2 and line.startswith('+'):
step = 3
continue
while step == 3:
#process the quality data
if len(qual) == len(seq):
#once the length of the quality seq and seq are the same, end gathering data
step = 1
continue
if len(qual) < len(seq):
qual = qual + line.strip()
if len(qual) < len(seq):
step = 3
continue
if (len(qual) > len(seq)):
sys.stderr.write('\nError: ' + ID + ' sequence length not equal to quality values\n')
comment,seq,qual= '','',''
ID = line
step = 1
continue
break
if ID is not None:
#Section reserved for last entry in file
if len(qual) > 0:
qual = [ord(char)-offset for char in qual]
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1)
if len(seq) == 0: ID,comment,seq,qual= '','','',''
yield ID, comment, seq, qual
my output is skipping the ID #m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs and adding #**! when it should not be in the output
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
Error: different_number_of_seq_qual sequence length not equal to quality values
#**!
+
#this_should_work
GGGG
+
****
You probably should use BioPython.
Your bug appears to be the read that is skipped has 129 bases in its sequence but only 128 qv. So your parser reads the next defline as a quality line which then makes it too long so it prints the error.
Then your states don't account for the situation of where you are in step 1 but dont see a defline. So you keep reading extra lines overwritting the ID variable.
but if you really want to write your own parser:
I'll address your questions one at a time.
when sequence length is different than number of quality values
This is invalid. Each record in the fastq file must have the an equal number of bases and qualities. Different records in the file can be different lengths from each other, but each record must have equal bases and qualities.
when there's an empty sequence or entry
An empty read will have blank lines for the sequence and quality lines like this:
#SOLEXA1_0007:1:9:610:1983#GATCAG/2
+SOLEXA1_0007:1:9:610:1983#GATCAG/2
#SOLEXA1_0007:2:13:163:254#GATCAG/2
CGTAGTACGATATACGCGCGTGTACTGCTACGTCTCACTTTCGCAAGATTGCTCAGCTCATTGATGCTCAATGCTGGGCCATATCTCTTTTCTTTTTTTC
+SOLEXA1_0007:2:13:163:254#GATCAG/2
HHHHGHHEHHHHHE=HAHCEGEGHAG>CHH>EG5#>5*ECE+>AEEECGG72B&A*)569B+03B72>5.A>+*A>E+7A#G<CAD?#############
when the number of lines with quality values is more than one
Due to the requirements from the first answer above. We know that the number of bases and qualities must match. Also there will never be an + character in the sequence block. So we can keep parsing the sequence block until we see a line that starts with +. Then we know we are done parsing sequence. Then we can keep parsing quality lines until we get the same number of qualities as is in the sequence. We can't rely on looking for any special characters because depending on the quality encoding, # could be a valid quality call.
Also as an aside, you appear to be splitting the sequence defline to parse out the optional comment. You have to be careful for CASAVA 1.8 format which stupidly has spaces. So you might need a regex to see if it's a CASAVA 1.8 format then don't split on whitespace etc.
Have you considered using one of the robust python packages that are available for dealing with this kind of data rather than writing a parser from scratch? In partincular I'd recommend checking out HTSeq

Python import txt formatting

I have an Excel file with a list of numbers and I saved it as a .txt file and then went to say:
open_file = open('list_of_numbers.txt','r')
for number in open_file:
number = int(number)
while x < 20000:
if (x > number):
print number
x = x + 100
y = y + 100
And I received this error message:
ValueError: invalid literal for int() with base 10: '2100.00\r\n'
How can I strip the ' and the \r\n'?
My ultimate goal is to create another column next to the column of numbers and, if the number is 145 for example,
145, '100-199'
167, '100-199'
1167, '1100-1199'
that sort of output.
Let's put it as an answer. The problem is not \r\n. The problem is that you try to parse string that contains a float value as an integer. See (no line feed, new line characters):
>>> int("2100.00")
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
ValueError: invalid literal for int() with base 10: '2100.00'
(as you can see, the quotation marks ' are not part of the value, they just indicate that you are dealing with a string)
whereas
>>> int("2100\r\n")
2100
The documentation says:
If the argument is a string, it must contain a possibly signed decimal number representable as a Python integer, possibly embedded in whitespace.
where the Python integer literal definition can be found here.
Solution:
Use float:
>>> float("2100.00\r\n")
2100.0
then you can convert it to an integer if you want to (also consider round):
>>> int(float("2100.00\r\n"))
2100
Converting a float value to integer works (from the documentation):
Conversion of floating point numbers to integers truncates (towards zero).
To address your immediate problem, go with the answer by #Felix Kling.
If you are interested in your FUTURE problems, please read on.
(1) That \r is not part of the problem IN THIS PARTICULAR CASE, but is intriguing: Are you creating the file on Windows and reading it on Linux/OSX/etc? If so, you should open your text file with "rU" (universal newlines), so that the input line on Python has only the \n.
(2) In any case, it's a very good idea to do line = line.rstrip('\n') ... otherwise, depending on how you split up the lines, you may end up with your last field containing an unwanted \n.
(3) You may prefer to use xlrd to read from an Excel file directly -- this saves all sorts of hassles. [Dis]claimer: I'm the author of xlrd.
Try this:
number = int(number.strip(string.whitespace + "'"))
You will need to add import string to the beginning of the your script. See also: http://docs.python.org/library/stdtypes.html#str.strip

Categories

Resources