this is a continuation of Generator not working to split string by particular identifier . Python 2 . however, i modified the code completely and it's not the same format at all. this is about edge cases
Edge Cases:
. when sequence length is different than number of quality values
. when there's an empty sequence or entry
. when the number of lines with quality values is more than one
i cannot figure out how to work with the edge cases above. If its an empty data file, then I still want to output empty strings. i'm trying with these sequences right here for my input file: (Just a little background, IDs are set by # at beginning of line, sequence characters are followed by the lines after until a line with + is reached. the next lines are going to have quality values (value ~= chr(char) ) this format is terrible and poorly thought out.
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs
CTCTCTCATCACACACGAGGAGTGAAGAGAGAACCTCCTCTCCACACGTGGAGTGAGGAGATCCTCTCACACACGTGAGGTGTTGAGAGAGATACTCTCTCATCACCTCACGTGAGGAGTGAGAGAGAT
+
{~~~~~sXNL>>||~~fVM~jtu~&&(uxy~f8YHh=<gA5
''<O1A44N'`oK57(((G&&Q*Q66;"$$Df66E~Z\ZMO>^;%L}~~~~~Q.~~~~x~#-LF9>~MMqbV~ABBV=99mhIwGRR~
#different_number_of_seq_qual
ATCG
+
**!
#this_should_work
GGGG
+
****
The ones with an error, I'm trying to replace the seq and qual strings with empty strings
seq,qual = '',''
Here's my code so far. These edge cases are so difficult for me to figure out please help . . .
def read_fastq(input, offset):
"""
Inputs a fastq file and reads each line at a time. 'offset' parameter can be set to 33 (phred+33 encoding
fastq), and 64. Yields a tuple in the format (ID, comments for a sequence, sequence, [integer quality values])
Capable of reading empty sequences and empty files.
"""
ID, comment, seq, qual = None,'','',''
step = 1 #step is a variable that organizes the order fastq parsing
#step= 1 scans for ID and comment line
#step= 2 adds relevant lines to sequence string
#step= 3 adds quality values to string
for line in input:
line = line.strip()
if step == 1 and line.startswith('#'): #Step system from Nedda Saremi
if ID is not None:
qual = [ord(char)-offset for char in qual] #Converts from phred encoding to integer values
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1) #Separates ID and comment by ' '
yield ID, comment, seq, qual
ID,comment,seq,qual = None,'','','' #Resets variable for next sequence
ID = line[1:]
step = 2
continue
if step==2 and not line.startswith('#') and not line.startswith('+'):
seq = seq + line.strip()
continue
if step == 2 and line.startswith('+'):
step = 3
continue
while step == 3:
#process the quality data
if len(qual) == len(seq):
#once the length of the quality seq and seq are the same, end gathering data
step = 1
continue
if len(qual) < len(seq):
qual = qual + line.strip()
if len(qual) < len(seq):
step = 3
continue
if (len(qual) > len(seq)):
sys.stderr.write('\nError: ' + ID + ' sequence length not equal to quality values\n')
comment,seq,qual= '','',''
ID = line
step = 1
continue
break
if ID is not None:
#Section reserved for last entry in file
if len(qual) > 0:
qual = [ord(char)-offset for char in qual]
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1)
if len(seq) == 0: ID,comment,seq,qual= '','','',''
yield ID, comment, seq, qual
my output is skipping the ID #m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs and adding #**! when it should not be in the output
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
Error: different_number_of_seq_qual sequence length not equal to quality values
#**!
+
#this_should_work
GGGG
+
****
You probably should use BioPython.
Your bug appears to be the read that is skipped has 129 bases in its sequence but only 128 qv. So your parser reads the next defline as a quality line which then makes it too long so it prints the error.
Then your states don't account for the situation of where you are in step 1 but dont see a defline. So you keep reading extra lines overwritting the ID variable.
but if you really want to write your own parser:
I'll address your questions one at a time.
when sequence length is different than number of quality values
This is invalid. Each record in the fastq file must have the an equal number of bases and qualities. Different records in the file can be different lengths from each other, but each record must have equal bases and qualities.
when there's an empty sequence or entry
An empty read will have blank lines for the sequence and quality lines like this:
#SOLEXA1_0007:1:9:610:1983#GATCAG/2
+SOLEXA1_0007:1:9:610:1983#GATCAG/2
#SOLEXA1_0007:2:13:163:254#GATCAG/2
CGTAGTACGATATACGCGCGTGTACTGCTACGTCTCACTTTCGCAAGATTGCTCAGCTCATTGATGCTCAATGCTGGGCCATATCTCTTTTCTTTTTTTC
+SOLEXA1_0007:2:13:163:254#GATCAG/2
HHHHGHHEHHHHHE=HAHCEGEGHAG>CHH>EG5#>5*ECE+>AEEECGG72B&A*)569B+03B72>5.A>+*A>E+7A#G<CAD?#############
when the number of lines with quality values is more than one
Due to the requirements from the first answer above. We know that the number of bases and qualities must match. Also there will never be an + character in the sequence block. So we can keep parsing the sequence block until we see a line that starts with +. Then we know we are done parsing sequence. Then we can keep parsing quality lines until we get the same number of qualities as is in the sequence. We can't rely on looking for any special characters because depending on the quality encoding, # could be a valid quality call.
Also as an aside, you appear to be splitting the sequence defline to parse out the optional comment. You have to be careful for CASAVA 1.8 format which stupidly has spaces. So you might need a regex to see if it's a CASAVA 1.8 format then don't split on whitespace etc.
Have you considered using one of the robust python packages that are available for dealing with this kind of data rather than writing a parser from scratch? In partincular I'd recommend checking out HTSeq
Related
I am following this tutorial (https://towardsdatascience.com/build-your-own-whatsapp-chat-analyzer-9590acca9014) to build a WhatsApp analyzer.
This is the entire code from his tutorial -
def startsWithDateTime(s):
pattern = '^([0-2][0-9]|(3)[0-1])(\/)(((0)[0-9])|((1)[0-2]))(\/)(\d{2}|\d{4}), ([0-9][0-9]):([0-9][0-9]) -'
result = re.match(pattern, s)
if result:
return True
return False
def startsWithAuthor(s):
patterns = [
'([\w]+):', # First Name
'([\w]+[\s]+[\w]+):', # First Name + Last Name
'([\w]+[\s]+[\w]+[\s]+[\w]+):', # First Name + Middle Name + Last Name
'([+]\d{2} \d{5} \d{5}):', # Mobile Number (India)
'([+]\d{2} \d{3} \d{3} \d{4}):', # Mobile Number (US)
'([+]\d{2} \d{4} \d{7})' # Mobile Number (Europe)
]
pattern = '^' + '|'.join(patterns)
result = re.match(pattern, s)
if result:
return True
return False
def getDataPoint(line):
# line = 18/06/17, 22:47 - Loki: Why do you have 2 numbers, Banner?
splitLine = line.split(' - ') # splitLine = ['18/06/17, 22:47', 'Loki: Why do you have 2 numbers, Banner?']
dateTime = splitLine[0] # dateTime = '18/06/17, 22:47'
date, time = dateTime.split(', ') # date = '18/06/17'; time = '22:47'
message = ' '.join(splitLine[1:]) # message = 'Loki: Why do you have 2 numbers, Banner?'
if startsWithAuthor(message): # True
splitMessage = message.split(': ') # splitMessage = ['Loki', 'Why do you have 2 numbers, Banner?']
author = splitMessage[0] # author = 'Loki'
message = ' '.join(splitMessage[1:]) # message = 'Why do you have 2 numbers, Banner?'
else:
author = None
return date, time, author, message
parsedData = [] # List to keep track of data so it can be used by a Pandas dataframe
conversationPath = 'chat.txt'
with open(conversationPath, encoding="utf-8") as fp:
fp.readline() # Skipping first line of the file (usually contains information about end-to-end encryption)
messageBuffer = [] # Buffer to capture intermediate output for multi-line messages
date, time, author = None, None, None # Intermediate variables to keep track of the current message being processed
while True:
line = fp.readline()
if not line: # Stop reading further if end of file has been reached
break
line = line.strip() # Guarding against erroneous leading and trailing whitespaces
if startsWithDateTime(line): # If a line starts with a Date Time pattern, then this indicates the beginning of a new message
print('true')
if len(messageBuffer) > 0: # Check if the message buffer contains characters from previous iterations
parsedData.append([date, time, author, ' '.join(messageBuffer)]) # Save the tokens from the previous message in parsedData
messageBuffer.clear() # Clear the message buffer so that it can be used for the next message
date, time, author, message = getDataPoint(line) # Identify and extract tokens from the line
messageBuffer.append(message) # Append message to buffer
else:
messageBuffer.append(line) # If a line doesn't start with a Date Time pattern, then it is part of a multi-line message. So, just append to buffer
When I plug in my chat file - chat.txt, I noticed that my list parsedData is empty. After going through his code, I noticed what might be responsible for the empty list.
From his tutorial, his chats are in this format (24hrs) -
18/06/17, 22:47 - Loki: Why do you have 2 numbers, Banner? but my chats are this format (12 hrs) - [4/19/20, 8:10:57 PM] Joe: How are you doing.
Reason why the startsWithDateTime function is unable to match any date and time.
Please how do I change the regex format in the startsWithDateTime function to match my chat format?
There are a few problems here.
First, your regex is looking for a date in the format DD/MM/YYYY, but the format you give is in M/DD/YYYY.
Second, the square brackets are not present in the first example you give, which succeeds, but are present in the second example.
Third, in looking at your regex, the problem isn't in the 12-hour v 24-hour time format per se, but in the fact that your regex is searching for a strictly 2-digit hour digit. When using 24-hour format, it is common to include a leading zero for single-digit hours (e.g., 08:10 for 8:10am), but in 12-hour format it is not (so your code would fail to find 8:10.
You can fix your regular expression by changing the relevant section from
([0-9][0-9]):([0-9][0-9])
to
([0-9]{1,2}):([0-9]{2})
The number in curly braces indicates how many examples of that character to look for, so in this case this expression will look for either one or two digits, then a colon, then exactly two digits.
Then the final regex would have to be
^\[(\d{1,2})\/(\d{2})\/(\d{2}|\d{4}), ([0-9]{1,2}):([0-9]{2}):([0-9]{2})\ ([AP]M)\]
Example:
import re
a = '[4/19/20, 8:10:57 PM] Joe: How are you doing'
p = r'^\[(\d{1,2})\/(\d{2})\/(\d{2}|\d{4}), ([0-9]{1,2}):([0-9]{2}):([0-9]{2})\ ([AP]M)\]'
re.findall(p, a)
# [('4', '19', '20', '8', '10', '57', 'PM')]
I have a txt file as here:
pid,party,state,res
SC5,Republican,NY,Donald Trump 45%-Marco Rubio 18%-John Kasich 18%-Ted Cruz 11%
TB1,Republican,AR,Ted Cruz 27%-Marco Rubio 23%-Donald Trump 23%-Ben Carson 11%
FX2,Democratic,MI,Hillary Clinton 61%-Bernie Sanders 34%
BN1,Democratic,FL,Hillary Clinton 61%-Bernie Sanders 30%
PB2,Democratic,OH,Hillary Clinton 56%-Bernie Sanders 35%
what I want to do, is check that the % of each "res" gets to 100%
def addPoll(pid,party,state,res,filetype):
with open('Polls.txt', 'a+') as file: # open file temporarly for writing and reading
lines = file.readlines() # get all lines from file
file.seek(0)
next(file) # go to next line --
#this is suppose to skip the 1st line with pid/pary/state/res
for line in lines: # loop
line = line.split(',', 3)[3]
y = line.split()
print y
#else:
#file.write(pid + "," + party + "," + state + "," + res+"\n")
#file.close()
return "pass"
print addPoll("123","Democratic","OH","bla bla 50%-Asd ASD 50%",'f')
So in my code I manage to split the last ',' and enter it into a list, but im not sure how I can get only the numbers out of that text.
You can use regex to find all the numbers:
import re
for line in lines:
numbers = re.findall(r'\d+', line)
numbers = [int(n) for n in numbers]
print(sum(numbers))
This will print
0 # no numbers in the first line
97
85
97
92
93
The re.findall() method finds all substrings matching the specified pattern, which in this case is \d+, meaning any continuous string of digits. This returns a list of strings, which we cast to a list of ints, then take the sum.
It seems like what you have is CSV. Instead of trying to parse that on your own, Python already has a builtin parser that will give you back nice dictionaries (so you can do line['res']):
import csv
with open('Polls.txt') as f:
reader = csv.DictReader(f)
for row in reader:
# Do something with row['res']
pass
For the # Do something part, you can either parse the field manually (it appears to be structured): split('-') and then rsplit(' ', 1) each - separated part (the last thing should be the percent). If you're trying to enforce a format, then I'd definitely go this route, but regex are also a fine solution too for quickly pulling out what you want. You'll want to read up on them, but in your case, you want \d+%:
# Manually parse (throws IndexError if there isn't a space separating candidate name and %)
percents = [candidate.rsplit(' ', 1)[1] for candidate row['res'].split('-')]
if not all(p.endswith('%') for p in percents):
# Handle bad percent (not ending in %)
pass
else:
# Throws ValueError if any of the percents aren't integers
percents = [int(p[:-1]) for p in percents]
if sum(percents) != 100:
# Handle bad total
pass
Or with regex:
percents = [int(match.group(1)) for match in re.finditer(r'(\d+)%', row['res'])]
if sum(percents) != 100:
# Handle bad total here
pass
Regex is certainly shorter, but the former will enforce more strict formatting requirements on row['res'] and will allow you to later extract things like candidate names.
Also some random notes:
You don't need to open with 'a+' unless you plan to append to the file, 'r' will do (and 'r' is implicit, so you don't have to specify it).
Instead of next() use a for loop!
I am attempting to create a regular expression pattern for strings similar to the below which are stored in a file. The aim is to get any column for any row, the rows need not be on a single line. So for example, consider the following file:
"column1a","column2a","column
3a,", #entity 1
"column\"this is, a test\"4a"
"column1b","colu
mn2b,","column3b", #entity 2
"column\"this is, a test\"4b"
"column1c,","column2c","column3c", #entity 3
"column\"this is, a test\"4c"
Each entity consists of four columns, column 4 for entity 2 would be "column\"this is, a test\"4b", column 2 for entity 3 would be "column2c". Each column begins with a quote and closes with a quote, however you must be careful because some columns have escaped quotes. Thanks in advance!
You could do like this, ie
Read the whole file.
Split the input according to the newline character which was not preceded by a comma.
Iterate over the spitted elements and again do splitting on the comma (and also the following optional newline character) which was preceded and followed by double quotes.
Code:
import re
with open(file) as f:
fil = f.read()
m = re.split(r'(?<!,)\n', fil.strip())
for i in m:
print(re.split('(?<="),\n?(?=")', i))
Output:
['"column1a"', '"column2a"', '"column3a,"', '"column\\"this is, a test\\"4a"']
['"column1b"', '"column2b,"', '"column3b"', '"column\\"this is, a test\\"4b"']
['"column1c,"', '"column2c"', '"column3c"', '"column\\"this is, a test\\"4c"']
Here is the check..
$ cat f
"column1a","column2a","column3a,",
"column\"this is, a test\"4a"
"column1b","column2b,","column3b",
"column\"this is, a test\"4b"
"column1c,","column2c","column3c",
"column\"this is, a test\"4c"
$ python3 f.py
['"column1a"', '"column2a"', '"column3a,"', '"column\\"this is, a test\\"4a"']
['"column1b"', '"column2b,"', '"column3b"', '"column\\"this is, a test\\"4b"']
['"column1c,"', '"column2c"', '"column3c"', '"column\\"this is, a test\\"4c"']
f is the input file name and f.py is the file-name which contains the python script.
Your problem is terribly familiar to what I have to deal thrice every month :) Except I'm not using python to solve it, but I can 'translate' what I usually do:
text = r'''"column1a","column2a","column
3a,",
"column\"this is, a test\"4a"
"column1a2","column2a2","column3a2","column4a2"
"column1b","colu
mn2b,","column3b",
"column\"this is, a test\"4b"
"column1c,","column2c","column3c",
"column\"this is, a test\"4c"'''
import re
# Number of columns one line is supposed to have
columns = 4
# Temporary variable to hold partial lines
buffer = ""
# Our regex to check for each column
check = re.compile(r'"(?:[^"\\]*|\\.)*"')
# Read the file line by line
for line in text.split("\n"):
# If there's no stored partial line, this is a new line
if buffer == "":
# Check if we get 4 columns and print, if not, put the line
# into buffer so we store a partial line for later
if len(check.findall(line)) == columns:
print matches
else:
# use line.strip() if you need to trim whitespaces
buffer = line
else:
# Update the variable (containing a partial line) with the
# next line and recheck if we get 4 columns
# use line.strip() if you need to trim whitespaces
buffer = buffer + line
# If we indeed get 4, our line is complete and print
# We must not forget to empty buffer now that we got a whole line
if len(check.findall(buffer)) == columns:
print matches
buffer = ""
# Optional; always good to have a safety backdoor though
# If there is a problem with the csv itself like a weird unescaped
# quote, you send it somewhere else
elif len(check.findall(buffer)) > columns:
print "Error: cannot parse line:\n" + buffer
buffer = ""
ideone demo
Is there a way I can get the position number of the mismatch from the following BLAT result using Python?
00000001 taaaagatgaagtttctatcatccaaaaaatgggctacagaaacc 00000045
<<<<<<<< ||||||||||||||||||||||||||| |||||||||||||||| <<<<<<<<
41629392 taaaagatgaagtttctatcatccaaagtatgggctacagaaacc 41629348
As we can see, there are two mismatches in the above output. Can we get the position number of the mismatch/mutation using Python. This is how it appears in the source code also. So I'm a little confused on how to proceed.
Thank you.
You can find the mismatches using the .find method of a string. Mismatches are indicated by a space (' '), so we look for that in the middle line of the blat output. I don't know blat personally, so I'm not sure if the output always comes in triplet lines, but assuming it does, the following function will return a list of positions mismatching, each position represented as a tuple of the mismatching position in the top sequence, and the same in the bottom sequence.
blat_src = """00000001 taaaagatgaagtttctatcatccaaaaaatgggctacagaaacc 00000045
<<<<<<<< ||||||||||||||||||||||||||| |||||||||||||||| <<<<<<<<
41629392 taaaagatgaagtttctatcatccaaagtatgggctacagaaacc 41629348"""
def find_mismatch(blat):
#break the blat input into lines
lines = blat.split("\n")
#give some firendly names to the different lines
seq_a = lines[0]
seq_b = lines[2]
#We're not interested in the '<' and '>' so we strip them out with a slice
matchstr = lines[1][9:-9]
#Get the integer values of the starts of each sequence segment
pos_a = int(seq_a[:8])
pos_b = int(seq_b[:8])
results = []
#find the index of first space character, mmpos = mismatch position
mmpos = matchstr.find(" ")
#if a space exists (-1 if none found)
while mmpos != -1:
#the position of the mismatch is the start position of the
#sequence plus the index within the segment
results.append((posa+mmpos, posb+mmpos))
#search the rest of the string (from mmpos+1 onwards)
mmpos = matchstr.find(" ", mmpos+1)
return results
print find_mismatch(blat_src)
Which produces
[(28, 41629419), (29, 41629420)]
Telling us positions 28 and 29 (indexed according to the top sequence) or positions 41629419 and 41629420 (indexed according to the bottom sequence) are mismatched.
I am a beginning python user (trying to learn for bioinformatics) and I am having difficulties in getting my final 'for loop' correct. I have used a web-based bioinformatic program to assess the subcellular localization of certain proteins (protein names and sequences contained within ORFs) and I am trying to parse the results (contained within targetp). The web-based program that I've used truncates the names of the proteins (and does not include sequences), and I would like to parse my results file such that I have the complete name and sequence of each protein in FASTA format (this entails having a '>' + the protein name on one line, and the protein sequence on the subsequent line). I think that everything is going well until the last block of code; I end up with the proper protein names, but they are all appended to the same sequence. I know that there must be something simple that I am doing wrong, but I just can't figure it out. Any ideas?
Thanks!
The ORFs file looks like this (it's FASTA, but the " shouldn't be there, only >):
">HsaNP_000700 branched chain keto acid dehydrogenase E1, alpha polypeptide
MAVAIAAARVWRLNRGLSQAALLLLRQPGARGLARSHPPRQQQQFSSLDDKPQFPGASAEFIDKLEFIQPNVISGIPIYRVMDRQGQIINPSEDPHLPKEKVLKLYKSMTLLNTMDRILYESQRQGRISFYMTNYGEEGTHVGSAAALDNTDLVFGQYREAGVLMYRDYPLELFMAQCYGNISDLGKGRQMPVHYGCKERHFVTISSPLATQIPQAVGAAYAAKRANANRVVICYFGEGAASEGDAHAGFNFAATLECPIIFFCRNNGYAISTPTSEQYRGDGIAARGPGYGIMSIRVDGNDVFAVYNATKEARRRAVAENQPFLIEAMTYRIGHHSTSDDSSAYRSVDEVNYWDKQDHPISRLRHYLLSQGWWDEEQEKAWRKQSRRKVMEAFEQAERKPKPNPNLLFSDVYQEMPAQLRKQQESLARHLQTYGEHYPLDHFDK
">HsaNP_060914 pyruvate dehydrogenase phosphatase precursor
MPAPTQLFFPLIRNCELSRIYGTACYCHHKHLCCSSSYIPQSRLRYTPHPAYATFCRPKENWWQYTQGRRYASTPQKFYLTPPQVNSILKANEYSFKVPEFDGKNVSSILGFDSNQLPANAPIEDRRSAATCLQTRGMLLGVFDGHAGCACSQAVSERLFYYIAVSLLPHETLLEIENAVESGRALLPILQWHKHPNDYFSKEASKLYFNSLRTYWQELIDLNTGESTDIDVKEALINAFKRLDNDISLEAQVGDPNSFLNYLVLRVAFSGATACVAHVDGVDLHVANTGDSRAMLGVQEEDGSWSAVTLSNDHNAQNERELERLKLEHPKSEAKSVVKQDRLLGLLMPFRAFGDVKFKWSIDLQKRVIESGPDQLNDNEYTKFIPPNYHTPPYLTAEPEVTYHRLRPQDKFLVLATDGLWETMHRQDVVRIVGEYLTGMHHQQPIAVGGYKVTLGQMHGLLTERRTKMSSVFEDQNAATHLIRHAVGNNEFGTVDHERLSKMLSLPEELARMYRDDITIIVVQFNSHVVGAYQNQE
The targetp file looks like this (the M is in position 57, but the formatting here throws this off):
HsaNP_000700 445 0.939 0.020 0.089 M 1
HsaNP_060914 537 0.309 0.073 0.629 _ 4
The leftmost column in targetp is the identifier (part of the header line in each protein sequence above), and I want to return only entries with an 'M' (i.e., not '_') in position 57, along with the protein name from ORFs (header line).
My script is:
#!/usr/bin/python
ORFs = open('Human.MitoCarta.fasta', 'U')
targetp = open('MitoCarta_TargetP_combined.out', 'U')
report = targetp.readlines()
protfile = open('mitocarta_no_mTP.fasta','w')
protid = []
seqdict = {}
for seq in ORFs:
seq = seq.rstrip()
if seq[0] == '':
continue
if seq[0] == '>':
name = seq[1:]
seqdict[name] = ''
continue
seqdict[name] += seq
for entry in report:
if entry.startswith('HsaNP'):
if entry[57] != 'M':
protid.append(entry[0:20])
protid = [x.strip(' ') for x in protid]
nameslist = seqdict.keys()
c = 0
for i in protid:
if i in nameslist[c]:
protfile.write('>%s\n%s\n\n' % (nameslist[c], seqdict[name]))
c += 1
protfile.close()
Yes, you are writing nameslist[c] and seqdict[name] but you never change 'name'. So you need to change 'name' if you want to get the different sequences. You should write:
protfile.write('>%s\n%s\n\n' % (nameslist[c], seqdict[nameslist[c]]))
That way you should get it right.