I have a txt file as here:
pid,party,state,res
SC5,Republican,NY,Donald Trump 45%-Marco Rubio 18%-John Kasich 18%-Ted Cruz 11%
TB1,Republican,AR,Ted Cruz 27%-Marco Rubio 23%-Donald Trump 23%-Ben Carson 11%
FX2,Democratic,MI,Hillary Clinton 61%-Bernie Sanders 34%
BN1,Democratic,FL,Hillary Clinton 61%-Bernie Sanders 30%
PB2,Democratic,OH,Hillary Clinton 56%-Bernie Sanders 35%
what I want to do, is check that the % of each "res" gets to 100%
def addPoll(pid,party,state,res,filetype):
with open('Polls.txt', 'a+') as file: # open file temporarly for writing and reading
lines = file.readlines() # get all lines from file
file.seek(0)
next(file) # go to next line --
#this is suppose to skip the 1st line with pid/pary/state/res
for line in lines: # loop
line = line.split(',', 3)[3]
y = line.split()
print y
#else:
#file.write(pid + "," + party + "," + state + "," + res+"\n")
#file.close()
return "pass"
print addPoll("123","Democratic","OH","bla bla 50%-Asd ASD 50%",'f')
So in my code I manage to split the last ',' and enter it into a list, but im not sure how I can get only the numbers out of that text.
You can use regex to find all the numbers:
import re
for line in lines:
numbers = re.findall(r'\d+', line)
numbers = [int(n) for n in numbers]
print(sum(numbers))
This will print
0 # no numbers in the first line
97
85
97
92
93
The re.findall() method finds all substrings matching the specified pattern, which in this case is \d+, meaning any continuous string of digits. This returns a list of strings, which we cast to a list of ints, then take the sum.
It seems like what you have is CSV. Instead of trying to parse that on your own, Python already has a builtin parser that will give you back nice dictionaries (so you can do line['res']):
import csv
with open('Polls.txt') as f:
reader = csv.DictReader(f)
for row in reader:
# Do something with row['res']
pass
For the # Do something part, you can either parse the field manually (it appears to be structured): split('-') and then rsplit(' ', 1) each - separated part (the last thing should be the percent). If you're trying to enforce a format, then I'd definitely go this route, but regex are also a fine solution too for quickly pulling out what you want. You'll want to read up on them, but in your case, you want \d+%:
# Manually parse (throws IndexError if there isn't a space separating candidate name and %)
percents = [candidate.rsplit(' ', 1)[1] for candidate row['res'].split('-')]
if not all(p.endswith('%') for p in percents):
# Handle bad percent (not ending in %)
pass
else:
# Throws ValueError if any of the percents aren't integers
percents = [int(p[:-1]) for p in percents]
if sum(percents) != 100:
# Handle bad total
pass
Or with regex:
percents = [int(match.group(1)) for match in re.finditer(r'(\d+)%', row['res'])]
if sum(percents) != 100:
# Handle bad total here
pass
Regex is certainly shorter, but the former will enforce more strict formatting requirements on row['res'] and will allow you to later extract things like candidate names.
Also some random notes:
You don't need to open with 'a+' unless you plan to append to the file, 'r' will do (and 'r' is implicit, so you don't have to specify it).
Instead of next() use a for loop!
Related
I am surprising, I am using python to slice a long DNA Sequence (4699673 character)to a specific length supstring, it's working properly with a problem in result, after 71 good result \n start apear in result for few slices then correct slices again and so on for whole long file
the code:
import sys
filename = open("out_filePU.txt",'w')
sys.stdout = filename
my_file = open("GCF_000005845.2_ASM584v2_genomic_edited.fna")
st = my_file.read()
length = len(st)
print ( 'Sequence Length is, :' ,length)
for i in range(0,len(st[:-9])):
print(st[i:i+9], i)
figure shows the error from the result file
please i need advice on that.
Your sequence file contains multiple lines, and at the end of each line there is a line break \n. You can remove them with st = my_file.read().replace("\n", "").
Try st = re.sub('\\s', '', my_file.read()) to replace any newlines or other whitespace (you'll need to add import re at the top of your script).
Then for i in range(0,len(st[:-9]),9): to step through your data in increments of nine characters. Otherwise you're only advancing by one character each time: that's why you can see the diagonal patterns in your output.
I'd like to write a python script that reads a text file containing this:
FRAME
1 J=1,8 SEC=CL1 NSEG=2 ANG=0
2 J=8,15 SEC=CL2 NSEG=2 ANG=0
3 J=15,22 SEC=CL3 NSEG=2 ANG=0
And output a text file that looks like this:
1 1 8
2 8 15
3 15 22
I essentially don't need the commas or the SEC, NSEG and ANG data. Could someone help me use regex to do this?
So far I have this:
import re
r = re.compile(r"\s*(\d+)\s+J=(\S+)\s+SEC=(\S+)\s+NSEG=(\S+)+ANG=(\S+)\s")
with open('RawDataFile_445.txt') as a:
# open all 4 files with a meaningful name
file=[open(outputfile.txt","w")
for line in a:
Without regex:
for line in file:
keep = []
line = line.strip()
if line.startswith('FRAME'):
continue
first, second, *_ = line.split()
keep.append(first)
first, second = second.split('=')
keep.extend(second.split(','))
print(' '.join(keep))
My advice? Since I don't write many regex's I avoid writing big ones all at once. Since you've already done that I would try to verify it a small chunk at a time, as illustrated in this code.
import re
r = re.compile(r"\s*(\d+)\s+J=(\S+)\s+SEC=(\S+)\s+NSEG=(\S+)+ANG=(\S+)\s")
r = re.compile(r"\s*(\d+)")
r = re.compile(r"\s*(\d+)\s+J=(\d+)")
with open('RawDataFile_445.txt') as a:
a.readline()
for line in a.readlines():
result = r.match(line)
if result:
print (result.groups())
The first regex is your entire brute of an expression. The next line is the first chunk I verified. The next line is the second, bigger chunk that worked. Notice the slight change.
At this point I would go back, make the correction to the original, whole regex and then copy a bigger chunk to try. And re-run.
Let's focus on an example string we want to parse:
1 J=1,8
We have space(s), digit(s), more space(s), some characters, then digit(s), a comma, and more digit(s). If we replace them with regex characters, we get (\d+)\s+J=(\d+),(\d+), where + means we want 1 or more of that type. Note that we surround the digits with parentheses so we can capture them later with .groups() or .group(#), where # is the nth group.
I am attempting to create a regular expression pattern for strings similar to the below which are stored in a file. The aim is to get any column for any row, the rows need not be on a single line. So for example, consider the following file:
"column1a","column2a","column
3a,", #entity 1
"column\"this is, a test\"4a"
"column1b","colu
mn2b,","column3b", #entity 2
"column\"this is, a test\"4b"
"column1c,","column2c","column3c", #entity 3
"column\"this is, a test\"4c"
Each entity consists of four columns, column 4 for entity 2 would be "column\"this is, a test\"4b", column 2 for entity 3 would be "column2c". Each column begins with a quote and closes with a quote, however you must be careful because some columns have escaped quotes. Thanks in advance!
You could do like this, ie
Read the whole file.
Split the input according to the newline character which was not preceded by a comma.
Iterate over the spitted elements and again do splitting on the comma (and also the following optional newline character) which was preceded and followed by double quotes.
Code:
import re
with open(file) as f:
fil = f.read()
m = re.split(r'(?<!,)\n', fil.strip())
for i in m:
print(re.split('(?<="),\n?(?=")', i))
Output:
['"column1a"', '"column2a"', '"column3a,"', '"column\\"this is, a test\\"4a"']
['"column1b"', '"column2b,"', '"column3b"', '"column\\"this is, a test\\"4b"']
['"column1c,"', '"column2c"', '"column3c"', '"column\\"this is, a test\\"4c"']
Here is the check..
$ cat f
"column1a","column2a","column3a,",
"column\"this is, a test\"4a"
"column1b","column2b,","column3b",
"column\"this is, a test\"4b"
"column1c,","column2c","column3c",
"column\"this is, a test\"4c"
$ python3 f.py
['"column1a"', '"column2a"', '"column3a,"', '"column\\"this is, a test\\"4a"']
['"column1b"', '"column2b,"', '"column3b"', '"column\\"this is, a test\\"4b"']
['"column1c,"', '"column2c"', '"column3c"', '"column\\"this is, a test\\"4c"']
f is the input file name and f.py is the file-name which contains the python script.
Your problem is terribly familiar to what I have to deal thrice every month :) Except I'm not using python to solve it, but I can 'translate' what I usually do:
text = r'''"column1a","column2a","column
3a,",
"column\"this is, a test\"4a"
"column1a2","column2a2","column3a2","column4a2"
"column1b","colu
mn2b,","column3b",
"column\"this is, a test\"4b"
"column1c,","column2c","column3c",
"column\"this is, a test\"4c"'''
import re
# Number of columns one line is supposed to have
columns = 4
# Temporary variable to hold partial lines
buffer = ""
# Our regex to check for each column
check = re.compile(r'"(?:[^"\\]*|\\.)*"')
# Read the file line by line
for line in text.split("\n"):
# If there's no stored partial line, this is a new line
if buffer == "":
# Check if we get 4 columns and print, if not, put the line
# into buffer so we store a partial line for later
if len(check.findall(line)) == columns:
print matches
else:
# use line.strip() if you need to trim whitespaces
buffer = line
else:
# Update the variable (containing a partial line) with the
# next line and recheck if we get 4 columns
# use line.strip() if you need to trim whitespaces
buffer = buffer + line
# If we indeed get 4, our line is complete and print
# We must not forget to empty buffer now that we got a whole line
if len(check.findall(buffer)) == columns:
print matches
buffer = ""
# Optional; always good to have a safety backdoor though
# If there is a problem with the csv itself like a weird unescaped
# quote, you send it somewhere else
elif len(check.findall(buffer)) > columns:
print "Error: cannot parse line:\n" + buffer
buffer = ""
ideone demo
this is a continuation of Generator not working to split string by particular identifier . Python 2 . however, i modified the code completely and it's not the same format at all. this is about edge cases
Edge Cases:
. when sequence length is different than number of quality values
. when there's an empty sequence or entry
. when the number of lines with quality values is more than one
i cannot figure out how to work with the edge cases above. If its an empty data file, then I still want to output empty strings. i'm trying with these sequences right here for my input file: (Just a little background, IDs are set by # at beginning of line, sequence characters are followed by the lines after until a line with + is reached. the next lines are going to have quality values (value ~= chr(char) ) this format is terrible and poorly thought out.
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs
CTCTCTCATCACACACGAGGAGTGAAGAGAGAACCTCCTCTCCACACGTGGAGTGAGGAGATCCTCTCACACACGTGAGGTGTTGAGAGAGATACTCTCTCATCACCTCACGTGAGGAGTGAGAGAGAT
+
{~~~~~sXNL>>||~~fVM~jtu~&&(uxy~f8YHh=<gA5
''<O1A44N'`oK57(((G&&Q*Q66;"$$Df66E~Z\ZMO>^;%L}~~~~~Q.~~~~x~#-LF9>~MMqbV~ABBV=99mhIwGRR~
#different_number_of_seq_qual
ATCG
+
**!
#this_should_work
GGGG
+
****
The ones with an error, I'm trying to replace the seq and qual strings with empty strings
seq,qual = '',''
Here's my code so far. These edge cases are so difficult for me to figure out please help . . .
def read_fastq(input, offset):
"""
Inputs a fastq file and reads each line at a time. 'offset' parameter can be set to 33 (phred+33 encoding
fastq), and 64. Yields a tuple in the format (ID, comments for a sequence, sequence, [integer quality values])
Capable of reading empty sequences and empty files.
"""
ID, comment, seq, qual = None,'','',''
step = 1 #step is a variable that organizes the order fastq parsing
#step= 1 scans for ID and comment line
#step= 2 adds relevant lines to sequence string
#step= 3 adds quality values to string
for line in input:
line = line.strip()
if step == 1 and line.startswith('#'): #Step system from Nedda Saremi
if ID is not None:
qual = [ord(char)-offset for char in qual] #Converts from phred encoding to integer values
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1) #Separates ID and comment by ' '
yield ID, comment, seq, qual
ID,comment,seq,qual = None,'','','' #Resets variable for next sequence
ID = line[1:]
step = 2
continue
if step==2 and not line.startswith('#') and not line.startswith('+'):
seq = seq + line.strip()
continue
if step == 2 and line.startswith('+'):
step = 3
continue
while step == 3:
#process the quality data
if len(qual) == len(seq):
#once the length of the quality seq and seq are the same, end gathering data
step = 1
continue
if len(qual) < len(seq):
qual = qual + line.strip()
if len(qual) < len(seq):
step = 3
continue
if (len(qual) > len(seq)):
sys.stderr.write('\nError: ' + ID + ' sequence length not equal to quality values\n')
comment,seq,qual= '','',''
ID = line
step = 1
continue
break
if ID is not None:
#Section reserved for last entry in file
if len(qual) > 0:
qual = [ord(char)-offset for char in qual]
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1)
if len(seq) == 0: ID,comment,seq,qual= '','','',''
yield ID, comment, seq, qual
my output is skipping the ID #m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs and adding #**! when it should not be in the output
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
Error: different_number_of_seq_qual sequence length not equal to quality values
#**!
+
#this_should_work
GGGG
+
****
You probably should use BioPython.
Your bug appears to be the read that is skipped has 129 bases in its sequence but only 128 qv. So your parser reads the next defline as a quality line which then makes it too long so it prints the error.
Then your states don't account for the situation of where you are in step 1 but dont see a defline. So you keep reading extra lines overwritting the ID variable.
but if you really want to write your own parser:
I'll address your questions one at a time.
when sequence length is different than number of quality values
This is invalid. Each record in the fastq file must have the an equal number of bases and qualities. Different records in the file can be different lengths from each other, but each record must have equal bases and qualities.
when there's an empty sequence or entry
An empty read will have blank lines for the sequence and quality lines like this:
#SOLEXA1_0007:1:9:610:1983#GATCAG/2
+SOLEXA1_0007:1:9:610:1983#GATCAG/2
#SOLEXA1_0007:2:13:163:254#GATCAG/2
CGTAGTACGATATACGCGCGTGTACTGCTACGTCTCACTTTCGCAAGATTGCTCAGCTCATTGATGCTCAATGCTGGGCCATATCTCTTTTCTTTTTTTC
+SOLEXA1_0007:2:13:163:254#GATCAG/2
HHHHGHHEHHHHHE=HAHCEGEGHAG>CHH>EG5#>5*ECE+>AEEECGG72B&A*)569B+03B72>5.A>+*A>E+7A#G<CAD?#############
when the number of lines with quality values is more than one
Due to the requirements from the first answer above. We know that the number of bases and qualities must match. Also there will never be an + character in the sequence block. So we can keep parsing the sequence block until we see a line that starts with +. Then we know we are done parsing sequence. Then we can keep parsing quality lines until we get the same number of qualities as is in the sequence. We can't rely on looking for any special characters because depending on the quality encoding, # could be a valid quality call.
Also as an aside, you appear to be splitting the sequence defline to parse out the optional comment. You have to be careful for CASAVA 1.8 format which stupidly has spaces. So you might need a regex to see if it's a CASAVA 1.8 format then don't split on whitespace etc.
Have you considered using one of the robust python packages that are available for dealing with this kind of data rather than writing a parser from scratch? In partincular I'd recommend checking out HTSeq
I have a folder with about 50 .txt files containing data in the following format.
=== Predictions on test data ===
inst# actual predicted error distribution (OFTd1_OF_Latency)
1 1:S 2:R + 0.125,*0.875 (73.84)
I need to write a program that combines the following: my index number (i), the letter of the true class (R or S), the letter of the predicted class, and each of the distribution predictions (the decimals less than 1.0).
I would like it to look like the following when finished, but preferably as a .csv file.
ID True Pred S R
1 S R 0.125 0.875
2 R R 0.105 0.895
3 S S 0.945 0.055
. . . . .
. . . . .
. . . . .
n S S 0.900 0.100
I'm a beginner and a bit fuzzy on how to get all of that parsed and then concatenated and appended. Here's what I was thinking, but feel free to suggest another direction if that would be easier.
for i in range(1, n):
s = str(i)
readin = open('mydata/output/output'+s+'out','r')
#The files are all named the same but with different numbers associated
output = open("mydata/summary.csv", "a")
storage = []
for line in readin:
#data extraction/concatenation here
if line.startswith('1'):
id = i
true = # split at the ':' and take the letter after it
pred = # split at the second ':' and take the letter after it
#some have error '+'s and some don't so I'm not exactly sure what to do to get the distributions
ds = # split at the ',' and take the string of 5 digits before it
if pred == 'R':
dr = #skip the character after the comma but take the have characters after
else:
#take the five characters after the comma
lineholder = id+' , '+true+' , '+pred+' , '+ds+' , '+dr
else: continue
output.write(lineholder)
I think using the indexes would be another option, but it might complicate things if the spacing is off in any of the files and I haven't checked this for sure.
Thank you for your help!
Well first of all, if you want to use CSV, you should use CSV module that comes with python. More about this module here: https://docs.python.org/2.7/library/csv.html I won't demonstrate how to use it, because it's pretty simple.
As for reading the input data, here's my suggestion how to break down every line of the data itself. I assume that lines of data in the input file have their values separated by spaces, and each value cannot contain a space:
def process_line(id_, line):
pieces = line.split() # Now we have an array of values
true = pieces[1].split(':')[1] # split at the ':' and take the letter after it
pred = pieces[2].split(':')[1] # split at the second ':' and take the letter after it
if len(pieces) == 6: # There was an error, the + is there
p4 = pieces[4]
else: # There was no '+' only spaces
p4 = pieces[3]
ds = p4.split(',')[0] # split at the ',' and take the string of 5 digits before it
if pred == 'R':
dr = p4.split(',')[0][1:] #skip the character after the comma but take the have??? characters after
else:
dr = p4.split(',')[0]
return id_+' , '+true+' , '+pred+' , '+ds+' , '+dr
What I mainly used here was split function of strings: https://docs.python.org/2/library/stdtypes.html#str.split and in one place this simple syntax of str[1:] to skip the first character of the string (strings are arrays after all, we can use this slicing syntax).
Keep in mind that my function won't handle any errors or lines formated differently than the one you posted as an example. If the values in every line are separated by tabs and not spaces you should replace this line: pieces = line.split() with pieces = line.split('\t').
i think u can separte floats and then combine it with the strings with the help of re module as follows:
import re
file = open('sample.txt','r')
strings=[[num for num in re.findall(r'\d+\.+\d+',i) for i in file.readlines()]]
print (strings)
file.close()
file = open('sample.txt','r')
num=[[num for num in re.findall(r'\w+\:+\w+',i) for i in file.readlines()]]
print (num)
s= num+strings
print s #[['1:S','2:R'],['0.125','0.875','73.84']] output of the code
this prog is written for one line u can use it for multiple line as well but u need to use a loop for that
contents of sample.txt:
1 1:S 2:R + 0.125,*0.875 (73.84)
2 1:S 2:R + 0.15,*0.85 (69.4)
when you run the prog the result will be:
[['1:S,'2:R'],['1:S','2:R'],['0.125','0.875','73.84'],['0.15,'0.85,'69.4']]
simply concatenate them
This uses regular expressions and the CSV module.
import re
import csv
matcher = re.compile(r'[[:blank:]]*1.*:(.).*:(.).* ([^ ]*),[^0-9]?(.*) ')
filenametemplate = 'mydata/output/output%iout'
output = csv.writer(open('mydata/summary.csv', 'w'))
for i in range(1, n):
for line in open(filenametemplate % i):
m = matcher.match(line)
if m:
output.write([i] + list(m.groups()))