Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
This question appears to be off-topic because it lacks sufficient information to diagnose the problem. Describe your problem in more detail or include a minimal example in the question itself.
Closed 8 years ago.
Improve this question
can you please tell me what is wrong with this code?
def insert_sequence(str1, str2, index):
'''The first two parameters are DNA sequences and the third parameter
is an index. Return the DNA sequence obtained by inserting the second
DNA sequence into the first DNA sequence at the given index.
>>>insert_sequence('CCGG', 'AT',2)
CCATGG
'''
str1 = str1[0:index] + str2 + str1[index:len(str1)]
return str1
Your docstring is indented one space further than the rest of the function body. Either dedent the docstring one space or indent the rest one space (probably the latter, since that would make it four spaces, if I'm counting right).
Python is very strict about the indentation, you therefore need to make sure all your blocks are aligned correctly, the problem here is therefore that the string is one space further than the two lines below. Make them aligned and you should be good.
Related
Closed. This question needs details or clarity. It is not currently accepting answers.
Want to improve this question? Add details and clarify the problem by editing this post.
Closed 1 year ago.
Improve this question
Like the title says, can I slice a sentence while ignoring whitespaces in Python?
For example, if the last letter of my word is sliced, the second letter of the following word needs to be sliced (while I'm using [::2]). I also have to preserve punctuations, so split isn't really an option. Replacing whitespaces isn't an option either, because I would have no way to put them back in the correct spot.
Sample input:
Myevmyozrtilets gwaaarkmv yuozub ubpi farfokm ctbhpe pientsfiydqe. zBmuvtk tahgelyu anlpsmo ttzevagrk yioquj awpyaoryts.
Expected output:
Memories warm you up from the inside. But they also tear you apart.
Sample implementation below.
Takes in consideration the punctuation (it looks like you've got it apart of the whitespace).
You'd enjoy trying to implement it on your own, I'm sure.
f="Myevmyozrtilets gwaaarkmv yuozub ubpi farfokm ctbhpe pientsfiydqe. zBmuvtk tahgelyu anlpsmo ttzevagrk yioquj awpyaoryts."
def g(f):
c=0
for l in f:
if l not in string.ascii_letters:
yield l
else:
if c%2==0:
yield l
c+=1
''.join(g(f))
'Memories warm you up from the inside. But they also tear you apart.'
Closed. This question needs to be more focused. It is not currently accepting answers.
Want to improve this question? Update the question so it focuses on one problem only by editing this post.
Closed 2 years ago.
Improve this question
for x in s[:].split():
s = s.replace(x, x.capitalize())
I want to know how the for loop will progress and what exactly s[:] means and will do?
Assuming s is a string, s[:] makes a copy of the string, and split() splits the string at spaces and returns an array of substrings, the for loop will then iterate over the substrings.
It's actually unnecessary because split returns an array, so even the though the for loop modifies the original string, the loop iterable isn't reevaluated multiple times, so you don't need to copy it.
s is very likely to be a string because the split is a method in str (of course, you can also say that s is an instance, which comes from a class that is defined by the user in which also has a split method ...)
Normally s[:] is like a slice. The following can help you to understand.
s ='abc AB C dd'
print(s)
print(s[:]) # same as s
print(s[:3]) # abc
print(s[4:6]) # AB
print(s[-1]) # d
for x in s[:].split():
s = s.replace(x, x.capitalize())
print(s) # Abc Ab C Dd # Now you know the capitalize is what, right?
digression
The following is a digression.
I think your question is very bad,
First, this question is very basic.
second, its subject is not good.
Note that an ideal Stack Overflow question is specific and narrow -- the idea is to be a huge FAQ.
And now, you tell me searching how the loop will work? I mean, if you are a programmer who must know how the loop it is.
so when you ask a question, you have to think twice about what the title name can benefit everyone. (not just you only)
I suggest that you can delete this question after you understand it.
Closed. This question needs debugging details. It is not currently accepting answers.
Edit the question to include desired behavior, a specific problem or error, and the shortest code necessary to reproduce the problem. This will help others answer the question.
Closed 4 years ago.
Improve this question
I want to replace every caret character with a unicode superscript, for nicer printing of equations in python. My problem is, every caret may be followed by a different exponent value, so in the unicode string u'\u00b*', the * wildcard needs to be the exponent I want to print in the string. I figured some regex would work for this, but my experience with that is very little.
For example, supposed I have a string
"x^3-x^2"
, I would then want this to be converted to the unicode string
u"x\u00b3-x\u00b2"
You can use re.sub and str.translate to catch exponents and change them to unicode superscripts.
import re
def to_superscript(num):
transl = str.maketrans(dict(zip('1234567890', '¹²³⁴⁵⁶⁷⁸⁹⁰')))
return num.translate(transl)
s = 'x^3-x^2'
out = re.sub('\^\s*(\d+)', lambda m: to_superscript(m[1]), s)
print(out)
Output
x³-x²
Closed. This question needs debugging details. It is not currently accepting answers.
Edit the question to include desired behavior, a specific problem or error, and the shortest code necessary to reproduce the problem. This will help others answer the question.
Closed 6 years ago.
Improve this question
I have a .txt file that has a really long RNAm sequence. I don´t know the exact length of the sequence.
What I need to do is extract the part of the sequence that is valid, meaning it starts with "AUG" and ends in "UAA" "UAG" or "UGA". Since the sequence is too long I don´t know the index of any of the letters or where the valid sequence is.
I need to save the new sequence in another variable.
Essentially, what you need to do, without coding the whole thing for you, is:
Example string:
rnaSequence = 'ACGUAFBHUAUAUAGAAAAUGGAGAGAGAAAAUUUGGGGGGGAAAAAAUAAAAAGGGUAUAUAGAUGAGAGAGA'
You will want to find the index of the 'AUG' and the index of 'UAA', 'UAG', or 'UGA' .. Something like this
rnaStart = rnaSequence.index(begin)
Then you'll need to set the slice of the string to a new variable
rnaSubstring = rnaSequence[rnaStart:rnaEnd+3]
Which in my string above, returns:
AUGGAGAGAGAAAAUUUGGGGGGGAAAAAAUAA
Closed. This question needs to be more focused. It is not currently accepting answers.
Want to improve this question? Update the question so it focuses on one problem only by editing this post.
Closed 7 years ago.
Improve this question
With the following expected input:
[u'able,991', u'about,11', u'burger,15', u'actor,22']
How can I split each string by the comma and return the second half of the string as an int?
This is what I have so far:
def split_fileA(line):
# split the input line in word and count on the comma
<ENTER_CODE_HERE>
# turn the count to an integer
<ENTER_CODE_HERE>
return (word, count)
One of the first things you'll need in learning how to code, is to get to know the set of functions and types you have natively available to you. Python's built-in functions is a good place to start. Also get the habit of consulting the documentation for the stuff you use; it's a good habit. In this case you'll need split and int. Split does pretty much what it says, it splits a given string into multiple tokens, given a separator. You'll find several examples with a simple search in google. int, on the other hand, parses a string (one of the things it does) into a numeric value.
In your case, this is what it means:
def split_fileA(line):
# split the input line in word and count on the comma
word, count = line.split(',')
# turn the count to an integer
count = int(count)
return (word, count)
You won't get this much here in stackoverflow, has other users are often reluctant to do your homework for you. It seems to me that you are at the very beginning of learning how to code so I hope this helps you get started, but remember that learning is also about trial and error.