Closed. This question needs debugging details. It is not currently accepting answers.
Edit the question to include desired behavior, a specific problem or error, and the shortest code necessary to reproduce the problem. This will help others answer the question.
Closed 6 years ago.
Improve this question
I have a .txt file that has a really long RNAm sequence. I don´t know the exact length of the sequence.
What I need to do is extract the part of the sequence that is valid, meaning it starts with "AUG" and ends in "UAA" "UAG" or "UGA". Since the sequence is too long I don´t know the index of any of the letters or where the valid sequence is.
I need to save the new sequence in another variable.
Essentially, what you need to do, without coding the whole thing for you, is:
Example string:
rnaSequence = 'ACGUAFBHUAUAUAGAAAAUGGAGAGAGAAAAUUUGGGGGGGAAAAAAUAAAAAGGGUAUAUAGAUGAGAGAGA'
You will want to find the index of the 'AUG' and the index of 'UAA', 'UAG', or 'UGA' .. Something like this
rnaStart = rnaSequence.index(begin)
Then you'll need to set the slice of the string to a new variable
rnaSubstring = rnaSequence[rnaStart:rnaEnd+3]
Which in my string above, returns:
AUGGAGAGAGAAAAUUUGGGGGGGAAAAAAUAA
Related
Closed. This question needs details or clarity. It is not currently accepting answers.
Want to improve this question? Add details and clarify the problem by editing this post.
Closed 1 year ago.
Improve this question
Given
a = "helloworld"
print(a[0][0][0][0])
When I run this program, it gave me "h" as output. Can someone explain how this works??
[0] always gets the first character, because it is the first index of the string (or list)
So, if you do print(a[0]), it would give the first character 'h'
If you add [0] to it, it would give the first character of 'h' which is 'h' itself
So, if you keep adding the [0], it would still give you 'h'
In every languages when it comes to an array it means you are considering a sequence of data's all together of same dataType in a such a manner that the first element is always present at index 0 and the last element is present at the (size of the array provided by the programmer) -1, basically it is a data structure that is used to store values of homogeneous type.
Closed. This question needs debugging details. It is not currently accepting answers.
Edit the question to include desired behavior, a specific problem or error, and the shortest code necessary to reproduce the problem. This will help others answer the question.
Closed 1 year ago.
Improve this question
I am trying to extract the variables between 2 constant substring in a string. For example,
I wish to extract the variable Apple, Orange, Watermelon, Kiwi....13cups, 14cups...19cups. I am using the re expression to get to the first step of taking the variable between $ sign but I do not get anything results.
Anyone can advise on the correct expression or if there is a better way to extract it ?
Thanks.
import re
file = '$n$n$n$xa0$n$nSHOWALL$nSHOWALL%GROWTH$n$n$xa0$n$xa0$n$n$n$nApple$na$nOrange$n$nWatermelon$nKiwi$n$nBanana$nJackfruit$n$nGuava$na$nGrape$n$nPlum$na$nOrange$n$nCoconut$nWatermelon$n$n12cups$n13cups$n$n14cups$na$n15cups$n$n16cups$na$n17cups$n$n18cups$n19cups$n'
found = re.findall(r'(?=$(.*?)$)',file)
print(found)
Given that the rule(s) for identifying the required character sequences is ambiguous, I contend that RE is impractical. No doubt it could be done but here's a quick'n'dirty approach to the problem:-
data = '$n$n$n$xa0$n$nSHOWALL$nSHOWALL%GROWTH$n$n$xa0$n$xa0$n$n$n$nApple$na$nOrange$n$nWatermelon$nKiwi$n$nBanana$nJackfruit$n$nGuava$na$nGrape$n$nPlum$na$nOrange$n$nCoconut$nWatermelon$n$n12cups$n13cups$n$n14cups$na$n15cups$n$n16cups$na$n17cups$n$n18cups$n19cups$n'
for token in data.split('$n'):
if token not in ('SHOWALL%GROWTH', 'SHOWALL', '$xa0', 'a', ''):
print(token)
Closed. This question needs debugging details. It is not currently accepting answers.
Edit the question to include desired behavior, a specific problem or error, and the shortest code necessary to reproduce the problem. This will help others answer the question.
Closed 4 years ago.
Improve this question
How do I search and replace using built-in Python methods?
For instance, with a string of appleorangegrapes (yes all of them joined),
Replace "apple" with "mango".
The .replace method only works if the words are evenly spaced out but not if they are combined as one. Is there a way around this?
I searched the web but again the .replace method only gives me an example if they are spaced out.
Thank you for looking at the problem!
This works exactly as expected and advertised. Have a look:
s = 'appleorangegrapes'
print(s) # -> appleorangegrapes
s = s.replace('apple', 'mango')
print(s) # -> mangoorangegrapes
The only thing that you have to be careful of is that replace is not an in-place operator and as such it does not update s automatically; it only creates a new string that you have to assign to something.
s = 'appleorangegrapes'
s.replace('apple', 'mango') # the change is made but not saved
print(s) # -> appleorangegrapes
replace can work for any string, why you think that it doesn't, here is the test:
>>> s='appleorangegrapes'
>>> s.replace('apple','mango')
'mangoorangegrapes'
>>>
Don't you see that you received your expected result?
Closed. This question needs debugging details. It is not currently accepting answers.
Edit the question to include desired behavior, a specific problem or error, and the shortest code necessary to reproduce the problem. This will help others answer the question.
Closed 5 years ago.
Improve this question
So I have a list of chars like
nodeList = ['A','C','E','G']
and I want to extract the A. So I found the list[number] method for extracting from a list. But when I put
node = nodeList[0]
I get an error saying that "'dict_keys' object does not support indexing." So how can I work around this? Thanks.
As stated in the comments, nodeList is not actually a list, but a dict_keys object. Before trying to index it, you may simply convert it to a list:
nodeList = list(nodeList)
node = nodeList[0]
Closed. This question needs debugging details. It is not currently accepting answers.
Edit the question to include desired behavior, a specific problem or error, and the shortest code necessary to reproduce the problem. This will help others answer the question.
Closed 7 years ago.
Improve this question
I am importing currency exchange rates from a website. All is well, except python prints the required data as follows:
['12.3098']
which means I can't use the data that I scraped in any calculations in my program. How do I get rid of the square brackets so that I can convert the string inside the square brackets to a float?
you have a list which is not a string... so if you want to get that value out select it like so
float(result[0])
replace 'result' with whatever your object is, aka what you printed ['12.3098']
try printing the type of your object type(result) and if its a list then this will fix your problem
if the type is a string you can do a literal evaluation of it like this
import ast
result = ast.literal_eval(result)
print result[0]