Develop Reference

Checking For Every Letter

I am trying to make code that breaks a password that I create, at first I got it to just make random answers to the password I created and eventually I would get the right one.
But I realized that if I could change the first letter of my answer and then when I had done all of the letters, change the second letter.
Ex: AA AB AC ... AY AZ BA BB BC.
I understand that I could make a loop to print every single letter, but how would I be able to change the first letter after I have gone through every letter.
I also need this to be able to break a password of any length so the loop would have to be able to change how many letters I need. I also need to get rid of the brackets and quotes in the output.
lower_upper_alphabet = ['a','b','c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z']
while done == 0:
for i in range (int(passwordlen)):
for i in range(52):
for i in range(len(lower_upper_alphabet)):
characters2 = []
characters2.append(str(lower_upper_alphabet[next1]))
next1 += 1
print(characters2)
Output:
["A"]
["B"]
["C"]
["D"]
["E"]
["F"]
["G"]
["H"]
["I"]
["J"]
["K"]
["L"]
["M"]
["N"]
["O"]
["P"]
["Q"]
["R"]
["S"]
["T"]
["U"]
["V"]
["W"]
["X"]
["Y"]
["Z"]

Printing a list from a random sample using join()

I am trying to print a python list using join after it has randomly selected a specified amount of characters. What I want is for it to print all characters beside each other instead of printing each character on a separate line. Everything works fine up until my for statement, if I print out password_letters it will print (on separate lines) the specified amount based on nr_letters. All I want is to join/concatenate the specified letters onto one line. I have followed the documentation on here and some on google, but I still can't find where I have gone wrong.
Please help me find where I have gone wrong in the below code:
import random
letters = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z']
nr_letters= int(input("How many letters would you like in your password?\n"))
password_letters = random.sample(letters, nr_letters )
for letter in password_letters:
print("".join(letter))

No need for a loop, just join the list.
print("".join(password_letters))

Python script to generate a word with specific structure and letter combinations

I want to write a really short script that will help me generate a random/nonsense word with the following qualities:
-Has 8 letters
-First letter is "A"
-Second and Fourth letters are random letters
-Fifth letter is a vowel
-Sixth and Seventh letters are random letters and are the same
-Eighth letter is a vowel that's not "a"
This is what I have tried so far (using all the info I could find and understand online)
firsts = 'A'
seconds = ['a','b','c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
thirds = ['a', 'e', 'i', 'o', 'u', 'y']
fourths = ['a','b','c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
fifths = ['a', 'e', 'i', 'o', 'u', 'y']
sixths = sevenths = ['a','b','c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
eighths = ['e', 'i', 'o', 'u', 'y']
print [''.join(first, second, third, fourth, fifth)
for first in firsts
for second in seconds
for third in thirds
for fourth in fourths
for fifth in fifths
for sixth in sixths
for seventh in sevenths
for eighth in eighths]
However it keeps showing a SyntaxError: invalid syntax after the for and now I have absolutely no idea how to make this work. If possible please look into this for me, thank you so much!

So the magic function you need to know about to pick a random letter is random.choice. You can pass a list into this function and it will give you a random element from that list. It also works with strings because strings are basically a list of chars. Also to make your life easier, use string module. string.ascii_lowercase returns all the letters from a to z in a string so you don't have to type it out. Lastly, you don't use loops to join strings together. Keep it simple. You can just add them together.
import string
from random import choice
first = 'A'
second = choice(string.ascii_lowercase)
third = choice(string.ascii_lowercase)
fourth = choice(string.ascii_lowercase)
fifth = choice("aeiou")
sixthSeventh = choice(string.ascii_lowercase)
eighth = choice("eiou")
word = first + second + third + fourth + fifth + sixthSeventh + sixthSeventh + eighth
print(word)

Try this:
import random
sixth=random.choice(sixths)
s='A'+random.choice(seconds)+random.choice(thirds)+random.choice(fourths)+random.choice(fifths)+sixth+sixth+random.choice(eighths)
print(s)
Output:
Awixonno
Ahiwojjy
etc

There are several things to consider. First, the str.join() method takes in an iterable (e.g. a list), not a bunch of individual elements. Doing
''.join([first, second, third, fourth, fifth])
fixes the program in this respect. If you are using Python 3, print() is a function, and so you should add parentheses around the entire list comprehension.
With the syntax out of the way, let's get to a more interesting problem: Your program constructs every (82255680 !) possible word. This takes a long time and memory. What you want is probably to just pick one. You can of course do this by first constructing all, then picking one at random. It's far cheaper though to pick one letter from each of firsts, seconds, etc. at random and then collecting these. All together then:
import random
firsts = ['A']
seconds = ['a','b','c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
thirds = ['a', 'e', 'i', 'o', 'u', 'y']
fourths = ['a','b','c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
fifths = ['a', 'e', 'i', 'o', 'u', 'y']
sixths = sevenths = ['a','b','c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
eighths = ['e', 'i', 'o', 'u', 'y']
result = ''.join([
random.choice(firsts),
random.choice(seconds),
random.choice(thirds),
random.choice(fourths),
random.choice(fifths),
random.choice(sixths),
random.choice(sevenths),
random.choice(eighths),
])
print(result)
To improve the code from here, try to:
Find a way to generate the "data" in a neater way than writing it out explicitly. As an example:
import string
seconds = list(string.ascii_lowercase) # you don't even need list()!
Instead of having a separate variable firsts, seconds, etc., collect these into a single variable, e.g. a single list containing each original list as a single str with all characters included.

This will implement what you describe. You can make the code neater by putting the choices into an overall list rather than have several different variables, but you will have to explicitly deal with the fact that the sixth and seventh letters are the same; they will not be guaranteed to be the same simply because there are the same choices available for each of them.
The list choices_list could contain sub-lists per your original code, but as you are choosing single characters it will work equally with strings when using random.choice and this also makes the code a bit neater.
import random
choices_list = [
'A',
'abcdefghijklmnopqrstuvwxyz',
'aeiouy',
'abcdefghijklmnopqrstuvwxyz',
'aeiouy',
'abcdefghijklmnopqrstuvwxyz',
'eiouy'
]
letters = [random.choice(choices) for choices in choices_list]
word = ''.join(letters[:6] + letters[5:]) # here the 6th letter gets repeated
print(word)
Some example outputs:
Alaeovve
Aievellu
Ategiwwo
Aeuzykko

Here's the syntax fix:
print(["".join([first, second, third])
for first in firsts
for second in seconds
for third in thirds])
This method might take up a lot of memory.

Using .join() function on a set incorrectly reorders it [duplicate]

This question already has answers here:
Converting a list to a set changes element order
(16 answers)
Closed 3 years ago.
I have a set of characters (x) that is ordered as I need it:
{'a',
'b',
'c',
'd',
'e',
'f',
'g',
'h',
'i',
'j',
'k',
'l',
'm',
'n',
'o',
'p',
'q',
'r',
's',
't',
'u',
'v',
'w',
'x',
'y',
'z'}
However, when I attempt to convert these back to a string using the .join() function:
return ' '.join(x)
The characters are being randomly reordered:
'c g e w i z n t l a q h p d f v m k b x u r j o y'
Any ideas as to what's going on here?

Sets don't "promise" to maintain order, sometimes they do, but they shouldn't be used with a dependency on it. Furthermore, consider using the following:
alpha = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
Then:
return " ".join(alpha)
However, if you only care about it being in alphabetical and want to use a set you can force it to be sorted before using the join function...
return " ".join(sorted(x))
Good luck!

Sets and dictionaries are unordered (pre Python 3.7). Their exact implementation involves hashtables and can be a little complicated. However, suffice it to say that the order you put elements into the set does not determine the order they are stored.
You can use OrderedDict or you can convert the set to a list, sort, and go from there.

Rosalind: Open Reading Frame

I am working through the 'Rosalind' problems and I've become stuck on what the issue with my code is... The problem is:
Either strand of a DNA double helix can serve as the coding strand for
RNA transcription. Hence, a given DNA string implies six total reading
frames, or ways in which the same region of DNA can be translated into
amino acids: three reading frames result from reading the string
itself, whereas three more result from reading its reverse complement.
An open reading frame (ORF) is one which starts from the start codon
and ends by stop codon, without any other stop codons in between.
Thus, a candidate protein string is derived by translating an open
reading frame into amino acids until a stop codon is reached.
Given: A DNA string s of length at most 1 kbp in FASTA format.
Return: Every distinct candidate protein string that can be translated
from ORFs of s. Strings can be returned in any order.
Here is my code (Python):
DNA_Codons = {
'TTT': 'F', 'CTT': 'L', 'ATT': 'I', 'GTT': 'V',
'TTC': 'F', 'CTC': 'L', 'ATC': 'I', 'GTC': 'V',
'TTA': 'L', 'CTA': 'L', 'ATA': 'I', 'GTA': 'V',
'TTG': 'L', 'CTG': 'L', 'ATG': 'M', 'GTG': 'V',
'TCT': 'S', 'CCT': 'P', 'ACT': 'T', 'GCT': 'A',
'TCC': 'S', 'CCC': 'P', 'ACC': 'T', 'GCC': 'A',
'TCA': 'S', 'CCA': 'P', 'ACA': 'T', 'GCA': 'A',
'TCG': 'S', 'CCG': 'P', 'ACG': 'T', 'GCG': 'A',
'TAT': 'Y', 'CAT': 'H', 'AAT': 'N', 'GAT': 'D',
'TAC': 'Y', 'CAC': 'H', 'AAC': 'N', 'GAC': 'D',
'TAA': '-', 'CAA': 'Q', 'AAA': 'K', 'GAA': 'E',
'TAG': '-', 'CAG': 'Q', 'AAG': 'K', 'GAG': 'E',
'TGT': 'C', 'CGT': 'R', 'AGT': 'S', 'GGT': 'G',
'TGC': 'C', 'CGC': 'R', 'AGC': 'S', 'GGC': 'G',
'TGA': '-', 'CGA': 'R', 'AGA': 'R', 'GGA': 'G',
'TGG': 'W', 'CGG': 'R', 'AGG': 'R', 'GGG': 'G'
}
bases={"A":"T",
"T":"A",
"G":"C",
"C":"G"}
def Pro(DNA, start, Rev):
#Calculates the Reverse compliment if using
if Rev == True:
reverse=DNA[::-1]
compliment=[]
for base in reverse:
compliment+=bases[base]
Seq="".join(compliment)
elif Rev== False:
Seq=DNA
Protein=[]
#Finds a start codon
for i in range(start, len(Seq),3):
codon=Seq[i:i+3]
if codon=="ATG":
#Starting from that start codon, returns a protein, breaks if stop codon
#-2 included so that it's always in blocks of 3
for j in range(i,len(Seq)-2,3):
new_codon=Seq[j:j+3]
if DNA_Codons[new_codon]!="-":
Protein+=[DNA_Codons[new_codon]]
else:
#Adds in the '-' to split proteins that start within the same Reading Frame
Protein+=[DNA_Codons[new_codon]]
break
return Protein
f = open('rosalind_orf.txt','r').read()
#Puts each FASTA String into an arrary
strings=f.split(">")
#removes the FASTA ID from the string in array and new line characters
for i in range(len(strings)):
strings[i]=strings[i].strip("Rosalind_0123456789")
strings[i]=strings[i].replace("\n","")
DNA=strings[1]
#Adds proteins from all Open Reading Frames
Proteins=[]
for i in range(len(DNA)):
Proteins+="".join(Pro(DNA,i,False)).split('-')
Proteins+="".join(Pro(DNA,i,True)).split('-')
#Mades a list of Unique Proteins and prints them
Unique_Proteins=[]
for p in Proteins:
if (p not in Unique_Proteins and p!=""):
Unique_Proteins+=[p]
print p
Using the sample data:
Rosalind_99 AGCCATGTAGCTAACTCAGGTTACATGGGGATGACCCCGCGACTTGGATTAGAGTCTCTTTTGGAATAAGCCTGAATGATCCGAGTAGCATCTCAG
My code works fine, however for every question dataset I've been given it fails...
Here is one of the question datasets that I've failed on:
Rosalind_1485 GACCAGAATGCGTTAGTCGGCCTCAGAGCGCACAAAAACCAGTATTTACAAAGTGGGACG
TAGCGCCCCGCGGCGTCCTTTTGCCCTATCGAAAGTATAGGCATCAGCTTTTTACCACCT
TGTCATAGGTAAACTGCCCGACCCAGGTCCGGCCCTCAGCCCAACGCAGATAAACCAAGG
TTATAGATGTGGCCTGTAGGCATATTGCTCTTAATGTTATAAAGAGCGAAGCGTGGTCTC
GGTTTGTAAACATTAATCAAATTCCCAGGCACTAAGCCATGGTCGCCCCGGATTGGTTTT
CCGGTGTACGCATCGGTGGCAGCTGGAGGGGACAGTTTAGGTGCTGCAATTGAACATGAA
ACTGCACGAAAGGTGGGGTGGGCCGGATCTTGCGGGCCTCGAAAGGGTAGTGTTCCTCTG
CTATCTAGTCCAATTACCTGTAGTATATATGATCAGGCCGTCGGTTACTTAGCTAAGTAA
CCGACGGCCTGATCATCTCCTAGGAAATGGTCCTGAATGCGAACTAGGTTCCGTGGAATG
ATGGGGCCCAGAGGAAACCTGTACGCAATGGATCCCGGACAGATAGACCGGGAGGTCTTG
CAACCTCTTGTGGGAGTTACAGGCCGTACCTGAATTGCCCTCGTACCATTTGAAATGGTG
CGACGCCTGTACGCAACAATCGTTCGCCTGGATAATACAGACGGCCATTTCTGTAGGAAC
GATACCGTAACGCGACGTCAGGCATGACGTTAACTGCGTCACGTTTCATACCACTATGTG
AGGTACCCACTCCTTCATTTACCGCGAGATAAAGAGCCACCACCACCTTCTCTTGGTTTC
CATGCGCCGATCGGCTAAACGTGCATCACATTCAGGCGAAGAGTCAAATGGAAGCTCGCA
ATTTTAGGCCTTTATGGCGAATATCCCGCAAGCCTTAGGCGCGT
Obviously this code is nowhere near efficient and there's lot that could be improved upon, I'm just curious as to why it's not working.