Program isn't giving me the output I want - python

I have a program that is reading a file 'flanking seqs' which contains columns of text each meaning something different:
1 1 44457990 TAA CTCTCCTAAAGGACC
1 1 44461833 TGA CCAGCCTGAAGGGCT
1 1 148594641 TAA CCACAATAAGCAGCT
1 1 43241066 TGA ACTCACTGAGAGTGG
1 1 43240880 TAG CTTCTCTAGGAATGG ...
First col: chromosome number, second col: DNA strand, third col: position of stop codon in DNA, fourth col: stop codon, fifth col: 6 bases upstream and downstream surrounding the stop codon, i.e. the flanking sequence of each stop codon.
Now, my program is supposed to read this file and extract the 3 bases before and after each stop codon from the flanking sequence column and write to a file containing two columns: the stop codon and then the flanking sequence. The file should contain flanking sequences of all three stop codons TAA, TAG and TGA, however when I run the program, it only gives me the flanking sequences for TGA stop codons, but not for the rest of them.
Here is an example of what the outfile looks like:
TGA GGGCTT 1
TGA GAACGT 2
TGA CTTCTT 17
TGA CACCCT 15
TGA GAACGG 1
TGA GAACGC 3
I can't see where I am going wrong but I'm not very experienced so I'm sure I am missing something simple. I'd appreciate any help in spotting my errors! Here is the code:
bases = ['A','T','C','G']
sequenceCount = {}
for x1 in bases:
for x2 in bases:
for x3 in bases:
for x4 in bases:
for x5 in bases:
for x6 in bases:
sequenceCount[x1+x2+x3+x4+x5+x6] = 0
infile = open('flanking seqs.txt','rU')
outfile = open('context resultsNEW.txt','w')
for line in infile:
parts = line.split('\t')
chromosome = parts[0]
position = int(parts[2])
stopcodon = parts[3]
flankseq = parts[4].strip()
flankseq = flankseq[3:6]+flankseq[9:12]
if flankseq in sequenceCount:
sequenceCount[flankseq] += 1
for s in sequenceCount:
outfile.write(stopcodon+'\t'+s+'\t'+str(sequenceCount[s])+'\n')

your outfile.write takes place outside of the for line in infile loop, so the value of stopcodon is always whatever value it had in the final line of your input text file.
If you're trying to correlate sequence counts against both stop codons and flank sequences, you'll need to use both variables as a key. If you don't know all stop codons ahead of time, you won't be able to initialize sequenceCount's values to 0 using your "multiple nested for loops" approach, so you should probably use a defaultdict.
from collections import defaultdict
sequenceCount = defaultdict(int)
infile = open('flanking seqs.txt','rU')
outfile = open('context resultsNEW.txt','w')
for line in infile:
parts = line.split('\t')
chromosome = parts[0]
position = int(parts[2])
stopcodon = parts[3]
flankseq = parts[4].strip()
flankseq = flankseq[3:6]+flankseq[9:12]
sequenceCount[flankseq, stopcodon] += 1
for key, value in sequenceCount.iteritems():
flankseq, stopcodon = key
outfile.write(stopcodon+'\t'+s+'\t'+str(sequenceCount[s])+'\n')

When you produce your output, you print the last stopcodon that was read from the file with every line, regardless of what values for stopcodon were used in the previous loop. Perhaps your sequenceCount dictionary needs to be indexed by a combination of stopcodon and flankseq?

Related

run a search over the items of a list, and save each search into a file

I have a data.dat file that has 3 columns: The 3rd column is just the numbers 1 to 6 repeated again and again:
( In reality, column 3 has numbers from 1 to 1917, but for a minimal working example, let's stick to 1 to 6 )
# Title
127.26 134.85 1
127.26 135.76 2
127.26 135.76 3
127.26 160.97 4
127.26 160.97 5
127.26 201.49 6
125.88 132.67 1
125.88 140.07 2
125.88 140.07 3
125.88 165.05 4
125.88 165.05 5
125.88 203.06 6
137.20 140.97 1
137.20 140.97 2
137.20 148.21 3
137.20 155.37 4
137.20 155.37 5
137.20 184.07 6
I would like to:
1) extract the lines that contain 1 in the 3rd column and save them to a file called mode_1.dat.
2) extract the lines that contain 2 in the 3rd column and save them to a file called mode_2.dat.
3) extract the lines that contain 3 in the 3rd column and save them to a file called mode_3.dat.
.
.
.
6) extract the lines that contain 6 in the 3rd column and save them to a file called mode_6.dat.
In order to accomplish this, I have:
a) defined a variable factor = 6
a) created a one_to_factor list that has numbers 1 to 6
b) The re.search statement is in charge of extracting the lines for each value of one_to_factor. %s are the i inside the one_to_factor list
c) append these results to an empty LINES list.
However, this does not work. I cannot manage to extract the lines that contain i in the 3rd column and save them to a file called mode_i.dat
I would appreciate if you could help me.
factor = 6
one_to_factor = range(1,factor+1)
LINES = []
f_2 = open('data.dat', 'r')
for line in f_2:
for i in one_to_factor:
if re.search(r' \b%s$' %i , line):
print 'line = ', line
LINES.append(line)
print 'LINES =' , LINES
I would do it like this:
no regexes, just use str.split() to split according to whitespace
use last item (the digit) of the current line to generate the filename
use a dictionary to open the file the first time, and reuse the handle for subsequent matches (write title line at file open)
close all handles in the end
code:
title_line="# Vol \t Freq \t Mod \n"
handles = dict()
next(f_2) # skip title
for line in f_2:
toks = line.split()
filename = "mode_{}.dat".format(toks[-1])
# create files first time id encountered
if filename in handles:
pass
else:
handles[filename] = open(filename,"w")
handles[filename].write(title_line) # write title
handles[filename].write(line)
# close all files
for v in handles.values():
v.close()
EDIT: that's the fastest way but the problem is if you have too many suffixes (like in your real example), you'll get "too many open files" exception. So for this case, there's a slightly less efficient method but which works too:
import glob,os
# pre-processing: cleanup old files if any
for f in glob.glob("mode_*.dat"):
os.remove(f)
next(f_2) # skip title
s = set()
title_line="# Vol \t Freq \t Mod \n"
for line in f_2:
toks = line.split()
filename = "mode_{}.dat".format(toks[-1])
with open(filename,"a") as f:
if filename in s:
pass
else:
s.add(filename)
f.write(title_line)
f.write(line)
It basically opens as append mode, writes the lines, and closes the file.
(the set is used to detect first write in this file, so title can be written before the data)
There's a directory cleanup first to ensure that no data is left from a previous computation (append mode expects that no file exists, and if input data set changes, there's a possibility that there's an indentifier not present in the new dataset, so there would be an "orphan" file remaining from previous run)
First, instead of looping on you one_to_factor, you can get the index in one step :
index = line[-1] # Last character on the line
Then, you can check if index is in your one_to_factor list.
You should created a dictionary of lists to store your lines.
Something like :
{ "1" : [line1, line7, ...],
"2" : ....
}
And then you can use the key of the dictionnary to create the file and populate it with lines.

Fastq parser not taking empty sequence (and other edge cases). Python

this is a continuation of Generator not working to split string by particular identifier . Python 2 . however, i modified the code completely and it's not the same format at all. this is about edge cases
Edge Cases:
. when sequence length is different than number of quality values
. when there's an empty sequence or entry
. when the number of lines with quality values is more than one
i cannot figure out how to work with the edge cases above. If its an empty data file, then I still want to output empty strings. i'm trying with these sequences right here for my input file: (Just a little background, IDs are set by # at beginning of line, sequence characters are followed by the lines after until a line with + is reached. the next lines are going to have quality values (value ~= chr(char) ) this format is terrible and poorly thought out.
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs
CTCTCTCATCACACACGAGGAGTGAAGAGAGAACCTCCTCTCCACACGTGGAGTGAGGAGATCCTCTCACACACGTGAGGTGTTGAGAGAGATACTCTCTCATCACCTCACGTGAGGAGTGAGAGAGAT
+
{~~~~~sXNL>>||~~fVM~jtu~&&(uxy~f8YHh=<gA5
''<O1A44N'`oK57(((G&&Q*Q66;"$$Df66E~Z\ZMO>^;%L}~~~~~Q.~~~~x~#-LF9>~MMqbV~ABBV=99mhIwGRR~
#different_number_of_seq_qual
ATCG
+
**!
#this_should_work
GGGG
+
****
The ones with an error, I'm trying to replace the seq and qual strings with empty strings
seq,qual = '',''
Here's my code so far. These edge cases are so difficult for me to figure out please help . . .
def read_fastq(input, offset):
"""
Inputs a fastq file and reads each line at a time. 'offset' parameter can be set to 33 (phred+33 encoding
fastq), and 64. Yields a tuple in the format (ID, comments for a sequence, sequence, [integer quality values])
Capable of reading empty sequences and empty files.
"""
ID, comment, seq, qual = None,'','',''
step = 1 #step is a variable that organizes the order fastq parsing
#step= 1 scans for ID and comment line
#step= 2 adds relevant lines to sequence string
#step= 3 adds quality values to string
for line in input:
line = line.strip()
if step == 1 and line.startswith('#'): #Step system from Nedda Saremi
if ID is not None:
qual = [ord(char)-offset for char in qual] #Converts from phred encoding to integer values
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1) #Separates ID and comment by ' '
yield ID, comment, seq, qual
ID,comment,seq,qual = None,'','','' #Resets variable for next sequence
ID = line[1:]
step = 2
continue
if step==2 and not line.startswith('#') and not line.startswith('+'):
seq = seq + line.strip()
continue
if step == 2 and line.startswith('+'):
step = 3
continue
while step == 3:
#process the quality data
if len(qual) == len(seq):
#once the length of the quality seq and seq are the same, end gathering data
step = 1
continue
if len(qual) < len(seq):
qual = qual + line.strip()
if len(qual) < len(seq):
step = 3
continue
if (len(qual) > len(seq)):
sys.stderr.write('\nError: ' + ID + ' sequence length not equal to quality values\n')
comment,seq,qual= '','',''
ID = line
step = 1
continue
break
if ID is not None:
#Section reserved for last entry in file
if len(qual) > 0:
qual = [ord(char)-offset for char in qual]
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1)
if len(seq) == 0: ID,comment,seq,qual= '','','',''
yield ID, comment, seq, qual
my output is skipping the ID #m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs and adding #**! when it should not be in the output
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
Error: different_number_of_seq_qual sequence length not equal to quality values
#**!
+
#this_should_work
GGGG
+
****
You probably should use BioPython.
Your bug appears to be the read that is skipped has 129 bases in its sequence but only 128 qv. So your parser reads the next defline as a quality line which then makes it too long so it prints the error.
Then your states don't account for the situation of where you are in step 1 but dont see a defline. So you keep reading extra lines overwritting the ID variable.
but if you really want to write your own parser:
I'll address your questions one at a time.
when sequence length is different than number of quality values
This is invalid. Each record in the fastq file must have the an equal number of bases and qualities. Different records in the file can be different lengths from each other, but each record must have equal bases and qualities.
when there's an empty sequence or entry
An empty read will have blank lines for the sequence and quality lines like this:
#SOLEXA1_0007:1:9:610:1983#GATCAG/2
+SOLEXA1_0007:1:9:610:1983#GATCAG/2
#SOLEXA1_0007:2:13:163:254#GATCAG/2
CGTAGTACGATATACGCGCGTGTACTGCTACGTCTCACTTTCGCAAGATTGCTCAGCTCATTGATGCTCAATGCTGGGCCATATCTCTTTTCTTTTTTTC
+SOLEXA1_0007:2:13:163:254#GATCAG/2
HHHHGHHEHHHHHE=HAHCEGEGHAG>CHH>EG5#>5*ECE+>AEEECGG72B&A*)569B+03B72>5.A>+*A>E+7A#G<CAD?#############
when the number of lines with quality values is more than one
Due to the requirements from the first answer above. We know that the number of bases and qualities must match. Also there will never be an + character in the sequence block. So we can keep parsing the sequence block until we see a line that starts with +. Then we know we are done parsing sequence. Then we can keep parsing quality lines until we get the same number of qualities as is in the sequence. We can't rely on looking for any special characters because depending on the quality encoding, # could be a valid quality call.
Also as an aside, you appear to be splitting the sequence defline to parse out the optional comment. You have to be careful for CASAVA 1.8 format which stupidly has spaces. So you might need a regex to see if it's a CASAVA 1.8 format then don't split on whitespace etc.
Have you considered using one of the robust python packages that are available for dealing with this kind of data rather than writing a parser from scratch? In partincular I'd recommend checking out HTSeq

Python 'for loop' to parse results

I am a beginning python user (trying to learn for bioinformatics) and I am having difficulties in getting my final 'for loop' correct. I have used a web-based bioinformatic program to assess the subcellular localization of certain proteins (protein names and sequences contained within ORFs) and I am trying to parse the results (contained within targetp). The web-based program that I've used truncates the names of the proteins (and does not include sequences), and I would like to parse my results file such that I have the complete name and sequence of each protein in FASTA format (this entails having a '>' + the protein name on one line, and the protein sequence on the subsequent line). I think that everything is going well until the last block of code; I end up with the proper protein names, but they are all appended to the same sequence. I know that there must be something simple that I am doing wrong, but I just can't figure it out. Any ideas?
Thanks!
The ORFs file looks like this (it's FASTA, but the " shouldn't be there, only >):
">HsaNP_000700 branched chain keto acid dehydrogenase E1, alpha polypeptide
MAVAIAAARVWRLNRGLSQAALLLLRQPGARGLARSHPPRQQQQFSSLDDKPQFPGASAEFIDKLEFIQPNVISGIPIYRVMDRQGQIINPSEDPHLPKEKVLKLYKSMTLLNTMDRILYESQRQGRISFYMTNYGEEGTHVGSAAALDNTDLVFGQYREAGVLMYRDYPLELFMAQCYGNISDLGKGRQMPVHYGCKERHFVTISSPLATQIPQAVGAAYAAKRANANRVVICYFGEGAASEGDAHAGFNFAATLECPIIFFCRNNGYAISTPTSEQYRGDGIAARGPGYGIMSIRVDGNDVFAVYNATKEARRRAVAENQPFLIEAMTYRIGHHSTSDDSSAYRSVDEVNYWDKQDHPISRLRHYLLSQGWWDEEQEKAWRKQSRRKVMEAFEQAERKPKPNPNLLFSDVYQEMPAQLRKQQESLARHLQTYGEHYPLDHFDK
">HsaNP_060914 pyruvate dehydrogenase phosphatase precursor
MPAPTQLFFPLIRNCELSRIYGTACYCHHKHLCCSSSYIPQSRLRYTPHPAYATFCRPKENWWQYTQGRRYASTPQKFYLTPPQVNSILKANEYSFKVPEFDGKNVSSILGFDSNQLPANAPIEDRRSAATCLQTRGMLLGVFDGHAGCACSQAVSERLFYYIAVSLLPHETLLEIENAVESGRALLPILQWHKHPNDYFSKEASKLYFNSLRTYWQELIDLNTGESTDIDVKEALINAFKRLDNDISLEAQVGDPNSFLNYLVLRVAFSGATACVAHVDGVDLHVANTGDSRAMLGVQEEDGSWSAVTLSNDHNAQNERELERLKLEHPKSEAKSVVKQDRLLGLLMPFRAFGDVKFKWSIDLQKRVIESGPDQLNDNEYTKFIPPNYHTPPYLTAEPEVTYHRLRPQDKFLVLATDGLWETMHRQDVVRIVGEYLTGMHHQQPIAVGGYKVTLGQMHGLLTERRTKMSSVFEDQNAATHLIRHAVGNNEFGTVDHERLSKMLSLPEELARMYRDDITIIVVQFNSHVVGAYQNQE
The targetp file looks like this (the M is in position 57, but the formatting here throws this off):
HsaNP_000700 445 0.939 0.020 0.089 M 1
HsaNP_060914 537 0.309 0.073 0.629 _ 4
The leftmost column in targetp is the identifier (part of the header line in each protein sequence above), and I want to return only entries with an 'M' (i.e., not '_') in position 57, along with the protein name from ORFs (header line).
My script is:
#!/usr/bin/python
ORFs = open('Human.MitoCarta.fasta', 'U')
targetp = open('MitoCarta_TargetP_combined.out', 'U')
report = targetp.readlines()
protfile = open('mitocarta_no_mTP.fasta','w')
protid = []
seqdict = {}
for seq in ORFs:
seq = seq.rstrip()
if seq[0] == '':
continue
if seq[0] == '>':
name = seq[1:]
seqdict[name] = ''
continue
seqdict[name] += seq
for entry in report:
if entry.startswith('HsaNP'):
if entry[57] != 'M':
protid.append(entry[0:20])
protid = [x.strip(' ') for x in protid]
nameslist = seqdict.keys()
c = 0
for i in protid:
if i in nameslist[c]:
protfile.write('>%s\n%s\n\n' % (nameslist[c], seqdict[name]))
c += 1
protfile.close()
Yes, you are writing nameslist[c] and seqdict[name] but you never change 'name'. So you need to change 'name' if you want to get the different sequences. You should write:
protfile.write('>%s\n%s\n\n' % (nameslist[c], seqdict[nameslist[c]]))
That way you should get it right.

How do you make tables with previously stored strings?

So the question basically gives me 19 DNA sequences and wants me to makea basic text table. The first column has to be the sequence ID, the second column the length of the sequence, the third is the number of "A"'s, 4th is "G"'s, 5th is "C", 6th is "T", 7th is %GC, 8th is whether or not it has "TGA" in the sequence. Then I get all these values and write a table to "dna_stats.txt"
Here is my code:
fh = open("dna.fasta","r")
Acount = 0
Ccount = 0
Gcount = 0
Tcount = 0
seq=0
alllines = fh.readlines()
for line in alllines:
if line.startswith(">"):
seq+=1
continue
Acount+=line.count("A")
Ccount+=line.count("C")
Gcount+=line.count("G")
Tcount+=line.count("T")
genomeSize=Acount+Gcount+Ccount+Tcount
percentGC=(Gcount+Ccount)*100.00/genomeSize
print "sequence", seq
print "Length of Sequence",len(line)
print Acount,Ccount,Gcount,Tcount
print "Percent of GC","%.2f"%(percentGC)
if "TGA" in line:
print "Yes"
else:
print "No"
fh2 = open("dna_stats.txt","w")
for line in alllines:
splitlines = line.split()
lenstr=str(len(line))
seqstr = str(seq)
fh2.write(seqstr+"\t"+lenstr+"\n")
I found that you have to convert the variables into strings. I have all of the values calculated correctly when I print them out in the terminal. However, I keep getting only 19 for the first column, when it should go 1,2,3,4,5,etc. to represent all of the sequences. I tried it with the other variables and it just got the total amounts of the whole file. I started trying to make the table but have not finished it.
So my biggest issue is that I don't know how to get the values for the variables for each specific line.
I am new to python and programming in general so any tips or tricks or anything at all will really help.
I am using python version 2.7
Well, your biggest issue:
for line in alllines: #1
...
fh2 = open("dna_stats.txt","w")
for line in alllines: #2
....
Indentation matters. This says "for every line (#1), open a file and then loop over every line again(#2)..."
De-indent those things.
This puts the info in a dictionary as you go and allows for DNA sequences to go over multiple lines
from __future__ import division # ensure things like 1/2 is 0.5 rather than 0
from collections import defaultdict
fh = open("dna.fasta","r")
alllines = fh.readlines()
fh2 = open("dna_stats.txt","w")
seq=0
data = dict()
for line in alllines:
if line.startswith(">"):
seq+=1
data[seq]=defaultdict(int) #default value will be zero if key is not present hence we can do +=1 without originally initializing to zero
data[seq]['seq']=seq
previous_line_end = "" #TGA might be split accross line
continue
data[seq]['Acount']+=line.count("A")
data[seq]['Ccount']+=line.count("C")
data[seq]['Gcount']+=line.count("G")
data[seq]['Tcount']+=line.count("T")
data[seq]['genomeSize']+=data[seq]['Acount']+data[seq]['Gcount']+data[seq]['Ccount']+data[seq]['Tcount']
line_over = previous_line_end + line[:3]
data[seq]['hasTGA']= data[seq]['hasTGA'] or ("TGA" in line) or (TGA in line_over)
previous_line_end = str.strip(line[-4:]) #save previous_line_end for next line removing new line character.
for seq in data.keys():
data[seq]['percentGC']=(data[seq]['Gcount']+data[seq]['Ccount'])*100.00/data[seq]['genomeSize']
s = '%(seq)d, %(genomeSize)d, %(Acount)d, %(Ccount)d, %(Tcount)d, %(Tcount)d, %(percentGC).2f, %(hasTGA)s'
fh2.write(s % data[seq])
fh.close()
fh2.close()

patterns searching in text

I have text file as follows seq.txt
>S1
AACAAGAAGAAAGCCCGCCCGGAAGCAGCTCAATCAGGAGGCTGGGCTGGAATGACAGCG
CAGCGGGGCCTGAAACTATTTATATCCCAAAGCTCCTCTCAGATAAACACAAATGACTGC
GTTCTGCCTGCACTCGGGCTATTGCGAGGACAGAGAGCTGGTGCTCCATTGGCGTGAAGT
CTCCAGGGCCAGAAGGGGCCTTTGTCGCTTCCTCACAAGGCACAAGTTCCCCTTCTGCTT
CCCCGAGAAAGGTTTGGTAGGGGTGGTGGTTTAGTGCCTATAGAACAAGGCATTTCGCTT
CCTAGACGGTGAAATGAAAGGGAAAAAAAGGACACCTAATCTCCTACAAATGGTCTTTAG
TAAAGGAACCGTGTCTAAGCGCTAAGAACTGCGCAAAGTATAAATTATCAGCCGGAACGA
GCAAACAGACGGAGTTTTAAAAGATAAATACGCATTTTTTTCCGCCGTAGCTCCCAGGCC
AGCATTCCTGTGGGAAGCAAGTGGAAACCCTATAGCGCTCTCGCAGTTAGGAAGGAGGGG
TGGGGCTGTCCCTGGATTTCTTCTCGGTCTCTGCAGAGACAATCCAGAGGGAGACAGTGG
ATTCACTGCCCCCAATGCTTCTAAAACGGGGAGACAAAACAAAAAAAAACAAACTTCGGG
TTACCATCGGGGAACAGGACCGACGCCCAGGGCCACCAGCCCAGATCAAACAGCCCGCGT
CTCGGCGCTGCGGCTCAGCCCGACACACTCCCGCGCAAGCGCAGCCGCCCCCCCGCCCCG
GGGGCCCGCTGACTACCCCACACAGCCTCCGCCGCGCCCTCGGCGGGCTCAGGTGGCTGC
GACGCGCTCCGGCCCAGGTGGCGGCCGGCCGCCCAGCCTCCCCGCCTGCTGGCGGGAGAA
ACCATCTCCTCTGGCGGGGGTAGGGGCGGAGCTGGCGTCCGCCCACACCGGAAGAGGAAG
TCTAAGCGCCGGAAGTGGTGGGCATTCTGGGTAACGAGCTATTTACTTCCTGCGGGTGCA
CAGGCTGTGGTCGTCTATCTCCCTGTTGTTC
>S2
ACACGCATTCACTAAACATATTTACTATGTGCCAGGCACTGTTCTCAGTGCTGGGGATAT
AGCAGTGAAGAAACAGAAACCCTTGCACTCACTGAGCTCATATCTTAGGGTGAGAAACAG
TTATTAAGCAAGATCAGGATGGAAAACAGATGGTACGGTAGTGTGAAATGCTAAAGAGAA
AAATAACTACGGAAAAGGGATAGGAAGTGTGTGTATCGCAGTTGACTTATTTGTTCGCGT
TGTTTACCTGCGTTCTGTCTGCATCTCCCACTAAACTGTAAGCTCTACATCTCCCATCTG
TCTTATTTACCAATGCCAACCGGGGCTCAGCGCAGCGCCTGACACACAGCAGGCAGCTGA
CAGACAGGTGTTGAGCAAGGAGCAAAGGCGCATCTTCATTGCTCTGTCCTTGCTTCTAGG
AGGCGAATTGGGAAATCCAGAGGGAAAGGAAAAGCGAGGAAAGTGGCTCGCTTTTGGCGC
TGGGGAAGAGGTGTACAGTGAGCAGTCACGCTCAGAGCTGGCTTGGGGGACACTCTCACG
CTCAGGAGAGGGACAGAGCGACAGAGGCGCTCGCAGCAGCGCGCTGTACAGGTGCAACAG
CTTAGGCATTTCTATCCCTATTTTTACAGCGAGGGACACTGGGCCTCAGAAAGGGAAGTG
CCTTCCCAAGCTCCAACTGCTCATAAGCAGTCAACCTTGTCTAAGTCCAGGTCTGAAGTC
CTGGAGCGATTCTCCACCCACCACGACCACTCACCTACTCGCCTGCGCTTCACCTCACGT
GAGGATTTTCCAGGTTCCTCCCAGTCTCTGGGTAGGCGGGGAGCGCTTAGCAGGTATCAC
CTATAAGAAAATGAGAATGGGTTGGGGGCCGGTGCAAGACAAGAATATCCTGACTGTGAT
TGGTTGAATTGGCTGCCATTCCCAAAACGAGCTTTGGCGCCCGGTCTCATTCGTTCCCAG
CAGGCCCTGCGCGCGGCAACATGGCGGGGTCCAGGTGGAGGTCTTGAGGCTATCAGATCG
GTATGGCATTGGCGTCCGGGCCCGCAAGGCG
.
.
.
.
I have to count patterns in these sequences to achieve python script
import re
infile = open("seq.txt", 'r')
out = open("pat.txt", 'w')
pattern = re.compile("GAAAT", flags=re.IGNORECASE)
for line in infile:
line = line.strip("\n")
if line.startswith('>'):
name = line
else:
s = re.findall(pattern,line)
print '%s:%s' %(name,s)
out.write('%s:\t%s\n' %(name,len(s)))
But it is giving the wrong result. The script is reading line by line.
S1 : 0
S1 : 0
S1 : 0
S1 : 0
S2 : 0
S2 : 1
S2 : 0
S2 : 1
But I want output as follows:
S1 : 0
S2 : 2
Can anybody help?
Use a hit counter, zero it if line.startswith('>'). Increment by len(s) otherwise.
This code might be helpful for you:
import re
pattern = re.compile("GAAAT", flags=re.IGNORECASE)
with open('seq.txt') as f:
sections = f.read().split('\n\n')
for section in sections:
lines = section.split()
name = lines[0].lstrip('>')
data = ''.join(lines[1:])
print '{0}: {1}'.format(name, len(pattern.findall(data)))
Example output:
S1: 1
S2: 2
Notes:
It's assumed that two newline characters are used to separate every section as in the example.
It's assumed that every section name is preceded by a greater than (>) character as in the example.
If you already have a pattern, use pattern.findall(data) instead of re.findall(pattern, data)
You should gather input until you enter the next pattern. This would also solve the corner case of where your pattern crosses a line boundary (not sure if that "can" happen with your data, but it looks like it).
Use a counter. Also, have your print function inside the for loop, so it's going to iterate as many times as the else condition. Note that it's also not a good idea to use the variable line as both the iterator variable in the for loop and as another variable. It makes the code more confusing.
counter_dict = {}
for line in infile:
if line[0] == '>':
name = line[1:len(line) - 2]
counter_dict[name] = 0
else:
counter_dict[name] += len(re.findall(pattern,line))
for (key, val) in counter_dict.items():
print '%s:%s' %(key, val)
out.write('%s:\t%s\n' %(key, val)

Categories

Resources