ID3v1 Null Byte parsing in python - python

I am writing a tool to parse ID3 tags from files an edit them in a GUI fashion. Up until now everything is great. However I am trying to remove the null byte terminators when displaying the info and then adding it back when user saves it to preserver the ID3v1 format. However when doing a check for the null terminator I get nothing.
This is the portion of the code related to the handlig of the tag:
if(bytes.decode(check) == "TAG"):
title = self.__clean(bytes.decode(f.read(30)))
artist = self.__clean(bytes.decode(f.read(30)))
album = self.__clean(bytes.decode(f.read(30)))
year = bytes.decode(f.read(4))
comment = self.__clean(bytes.decode(f.read(30)))
tmp_gen = bytes.decode(f.read(1))
genre = self.__clean(Utils.genreByteToString(tmp_gen))
return TagV1(title, artist, album, year, comment, genre)
return None
The clean method is here:
def __clean(self, string):
counter = 0
for i in range(0, len(string)):
w = string[i]
if(not w.strip()) or b"\00" == w or w == b"00" or w == bytes.decode(b"\00"):
counter+=1
else:
counter = 0
if(counter == 2):
return string[0:i-1]
return string
I've tried every possible combination know of null byte. Either not w or not w.split() I even tried putting it in bytes and then looping thorught that for null byte but still nothing. My counter always stays 0 on the debugger. Also when trying to copy the value from the debugger it appears as this which is an empty space. In the debugger it appears as an empty square. I would appreciate the input.
Using PyChar 2017 1.4

I figured out that the only solution that works is to use
w == str.decode(b"\00") or rstrip("\0")
as denoted by Marteen
Everything else seems to not work. However there are still some places where it doesn't work. For example the comment in the file I am trying doesn't have null bytes until the last one.
Upon further inspection with a hex editor I have found some odd characters. The comment continues on with the \20 character in hex until position 29 where a null character is (for denoting it has a track indicator) the next character is a \01 for the track. Oddly the genre indicator is a 0C which translates to (cannot paste it, it's a box with ceros in it).
EDIT: Using the __clean() method checking for decoded null terminator aswell as w.isspace() seemed to fix the issue in both other cases.

Related

QScintilla syntax highlighting with QsciLexerCustom - UTF-8 issue with german characters

Much like this related question, I found myself using QScintilla to create a syntax highlighter that has to deal with non-ASCII characters (é, ä, ß, etc...). I use the trick described in the comments of that question to solve the problem, styling the characters base on the length of the utf-8 bytes rather than the Latin-1 bytes. When styling the entire document, it works fine.
However, my issue arises when using the start/end parameters to only style part of the document as there seems to be a mismatch between the start/end parameters and the actual length of the text being styled. I need to use this as I am dealing with large files that cause a 1-2 second input delay if I continuously style the entire document.
I have the following very simple example:
é
; Comment
When I open the file, which runs the highlighter from start to finish it looks like that:
However, if I remove and re-type the comment, the colouring will always be one letter off.
This effect stacks indefinitely, with every non-ASCII character, the colouring goes off by another letter until it is a mess.
I have provided my overridden styleText method below.
def styleText(self, start: int, end: int) -> None:
if self.first_pass:
self.startStyling(0)
text = self.parent().text()
self.first_pass = False
else:
self.startStyling(start)
text = self.parent().text()[start:end]
p = re.compile(r"[*]\/|\/[*]|\s+|\w+|\W")
token_list = [(token, len(bytearray(token, "utf-8"))) for token in p.findall(text)]
editor = self.parent()
apply_until_linebreak = None
if start > 0:
previous_style_nr = editor.SendScintilla(editor.SCI_GETSTYLEAT, start - 1)
if previous_style_nr in [2, 3]:
apply_until_linebreak = previous_style_nr
for i, token in enumerate(token_list):
if apply_until_linebreak is not None:
if "\n" in token[0]:
apply_until_linebreak = None
self.setStyling(token[1], 0)
else:
self.setStyling(token[1], apply_until_linebreak)
else:
if token[0].isdigit() or token[0] in ["%"]:
self.setStyling(token[1], 1)
elif token[0] == "#":
apply_until_linebreak = 2
self.setStyling(token[1], 2)
elif token[0] in ["/", ";"]:
apply_until_linebreak = 3
self.setStyling(token[1], 3)
elif token[0].lower() == "end":
self.setStyling(token[1], 4)
else:
self.setStyling(token[1], 0)

Add linebreaks after N special characters are observed

I have a requirement wherein I have a CSV file which has data in a wrong format. However based on the number pipes I need to add a newline character and make the data ready for Consumption.
Can we count the number pipes and add newline \ncharacter?
Example:
sadasd|asdasd|l||||0sds|sdsds|2||||0sdsd|asdasd|l||||0
Expected output:
sadasd|asdasd|l||||0
sds|sdsds|2||||0
sdsd|asdasd|l||||0 .
Something like this?
_in = "sadasd|asdasd|l||||0sds|sdsds|2||||0sdsd|asdasd|l||||0"
_out = ""
pipeCount = 0
for char in _in:
if pipeCount == 6:
_out = _out+char+"\n"
pipeCount = 0
else:
_out = _out+char
if char == "|":
pipeCount += 1
print(_out)
I am not sure I understood the criterion for adding newline (See comments on question), but my output conforms with your expectation:
sadasd|asdasd|l||||0
sds|sdsds|2||||0
sdsd|asdasd|l||||0
Output is still a string, but you can just as easily make it a list of string.

Fastq parser not taking empty sequence (and other edge cases). Python

this is a continuation of Generator not working to split string by particular identifier . Python 2 . however, i modified the code completely and it's not the same format at all. this is about edge cases
Edge Cases:
. when sequence length is different than number of quality values
. when there's an empty sequence or entry
. when the number of lines with quality values is more than one
i cannot figure out how to work with the edge cases above. If its an empty data file, then I still want to output empty strings. i'm trying with these sequences right here for my input file: (Just a little background, IDs are set by # at beginning of line, sequence characters are followed by the lines after until a line with + is reached. the next lines are going to have quality values (value ~= chr(char) ) this format is terrible and poorly thought out.
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs
CTCTCTCATCACACACGAGGAGTGAAGAGAGAACCTCCTCTCCACACGTGGAGTGAGGAGATCCTCTCACACACGTGAGGTGTTGAGAGAGATACTCTCTCATCACCTCACGTGAGGAGTGAGAGAGAT
+
{~~~~~sXNL>>||~~fVM~jtu~&&(uxy~f8YHh=<gA5
''<O1A44N'`oK57(((G&&Q*Q66;"$$Df66E~Z\ZMO>^;%L}~~~~~Q.~~~~x~#-LF9>~MMqbV~ABBV=99mhIwGRR~
#different_number_of_seq_qual
ATCG
+
**!
#this_should_work
GGGG
+
****
The ones with an error, I'm trying to replace the seq and qual strings with empty strings
seq,qual = '',''
Here's my code so far. These edge cases are so difficult for me to figure out please help . . .
def read_fastq(input, offset):
"""
Inputs a fastq file and reads each line at a time. 'offset' parameter can be set to 33 (phred+33 encoding
fastq), and 64. Yields a tuple in the format (ID, comments for a sequence, sequence, [integer quality values])
Capable of reading empty sequences and empty files.
"""
ID, comment, seq, qual = None,'','',''
step = 1 #step is a variable that organizes the order fastq parsing
#step= 1 scans for ID and comment line
#step= 2 adds relevant lines to sequence string
#step= 3 adds quality values to string
for line in input:
line = line.strip()
if step == 1 and line.startswith('#'): #Step system from Nedda Saremi
if ID is not None:
qual = [ord(char)-offset for char in qual] #Converts from phred encoding to integer values
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1) #Separates ID and comment by ' '
yield ID, comment, seq, qual
ID,comment,seq,qual = None,'','','' #Resets variable for next sequence
ID = line[1:]
step = 2
continue
if step==2 and not line.startswith('#') and not line.startswith('+'):
seq = seq + line.strip()
continue
if step == 2 and line.startswith('+'):
step = 3
continue
while step == 3:
#process the quality data
if len(qual) == len(seq):
#once the length of the quality seq and seq are the same, end gathering data
step = 1
continue
if len(qual) < len(seq):
qual = qual + line.strip()
if len(qual) < len(seq):
step = 3
continue
if (len(qual) > len(seq)):
sys.stderr.write('\nError: ' + ID + ' sequence length not equal to quality values\n')
comment,seq,qual= '','',''
ID = line
step = 1
continue
break
if ID is not None:
#Section reserved for last entry in file
if len(qual) > 0:
qual = [ord(char)-offset for char in qual]
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1)
if len(seq) == 0: ID,comment,seq,qual= '','','',''
yield ID, comment, seq, qual
my output is skipping the ID #m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs and adding #**! when it should not be in the output
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
Error: different_number_of_seq_qual sequence length not equal to quality values
#**!
+
#this_should_work
GGGG
+
****
You probably should use BioPython.
Your bug appears to be the read that is skipped has 129 bases in its sequence but only 128 qv. So your parser reads the next defline as a quality line which then makes it too long so it prints the error.
Then your states don't account for the situation of where you are in step 1 but dont see a defline. So you keep reading extra lines overwritting the ID variable.
but if you really want to write your own parser:
I'll address your questions one at a time.
when sequence length is different than number of quality values
This is invalid. Each record in the fastq file must have the an equal number of bases and qualities. Different records in the file can be different lengths from each other, but each record must have equal bases and qualities.
when there's an empty sequence or entry
An empty read will have blank lines for the sequence and quality lines like this:
#SOLEXA1_0007:1:9:610:1983#GATCAG/2
+SOLEXA1_0007:1:9:610:1983#GATCAG/2
#SOLEXA1_0007:2:13:163:254#GATCAG/2
CGTAGTACGATATACGCGCGTGTACTGCTACGTCTCACTTTCGCAAGATTGCTCAGCTCATTGATGCTCAATGCTGGGCCATATCTCTTTTCTTTTTTTC
+SOLEXA1_0007:2:13:163:254#GATCAG/2
HHHHGHHEHHHHHE=HAHCEGEGHAG>CHH>EG5#>5*ECE+>AEEECGG72B&A*)569B+03B72>5.A>+*A>E+7A#G<CAD?#############
when the number of lines with quality values is more than one
Due to the requirements from the first answer above. We know that the number of bases and qualities must match. Also there will never be an + character in the sequence block. So we can keep parsing the sequence block until we see a line that starts with +. Then we know we are done parsing sequence. Then we can keep parsing quality lines until we get the same number of qualities as is in the sequence. We can't rely on looking for any special characters because depending on the quality encoding, # could be a valid quality call.
Also as an aside, you appear to be splitting the sequence defline to parse out the optional comment. You have to be careful for CASAVA 1.8 format which stupidly has spaces. So you might need a regex to see if it's a CASAVA 1.8 format then don't split on whitespace etc.
Have you considered using one of the robust python packages that are available for dealing with this kind of data rather than writing a parser from scratch? In partincular I'd recommend checking out HTSeq

python - determining the end of a field reading binary file

I'm working with a binary save game file, the file contains a number of fields most are fixed but there are sveral variable length fields which I'm having issues parsing because I don't know the length of them. What I am trying to do is read from a known offset until it reaches either a nullbyte or or returns nothing with that I would then be able to generare the offset for the next field.
The file I'm working with is www.retro-gaming-world.com/SAVE.DAT
the beggining of the field is at 0x8C30 having issues foguring out where it ends though.
I tried doing this with the following code but I don't think I'm going about this right.
while catch:
if "0" in temp2:
print "found it"
print temp2
print hex(infile.tell())
break
temp = infile.read(1)
temp2 += temp
You should use '\0' to represent null character:
>>> ord('0')
48
>>> ord('\0')
0

How can I update QTextEdit as user writes on it? (on Python)

I'm working on a Python+Qt WebSMS app/script. It asks for a number and message, and sends it to Vodafone via mechanize. Since Vodafone of my country doesn't support UTF-8, at least for WebSMS and every SMS should be shorter than 160 chars, I'm using this setup:
def setMesaj():
global mesaj
mesaj = unicode(self.textEdit.toPlainText().toUtf8(), "utf-8")
mesaj = mesaj.encode("ascii", "ignore")
if (len(mesaj)) > 159:
print "[WARN-1] Mesaj 160 karakterden fazla?"
i = len(mesaj) - 159
mesaj = mesaj [:-i]
print mesaj
QtCore.QObject.connect(self.textEdit, QtCore.SIGNAL("textChanged()"), setMesaj)
Well, It works. If message goes over 160 chars, the last letter is automatically removed, and If user tries to type any "weird" character, It's not accepted.
Here's my question: The variable 'mesaj' works perfectly, but It doesn't update the QTextEdit thing, so when It doesn't get anything over 160 chars (or Unicode), it still looks like allowed to the user. So, how can I update QTextEdit as user writes on it and make the changes appear syncronized?
Thanks,
def setMesaj(self):
mesaj = unicode(self.toPlainText().toUtf8(), "utf-8")
ascii = mesaj.encode("ascii", "ignore")
if ascii != mesaj:
self.setPlainText(ascii)
if (len(mesaj)) > 159:
QtGui.QMessageBox.warning(self, 'warning', "[WARN-1] Mesaj 160 karakterden fazla?")
i = len(mesaj) - 159
mesaj = mesaj [:-i]
self.setPlainText(mesaj)
This would be my quick and dirty approach, however you still have to put the text cursor in the correct position after making the edits.
One way to detect the right position for the text cursor would be to use codecs.register_error to define a custom error function, one that duplicates "ignore", but also remembers how many characters in front of the cursor were deleted, and to shift the cursor that many positions to the left after encoding.

Categories

Resources