How to display tkinter polygons on canvas under 3D conditions? - python

I'm trying to create a program that renders an object in 3D and that you can rotate and control with your mouse's position. I'm trying to display the faces of the object but I don't know how could I display the closer faces first so that there isn't any 'background' face displayed in front of closer faces.
the code I provided is fully reproducable, just copy and paste it if you have tkinter and numpy.
from numpy import *
from tkinter import *
#eulers angles matrixes
def Rx(theta):
return mat(mat([[1, 0 , 0 ],
[0, cos(theta), -sin(theta)],
[0, sin(theta), cos(theta) ]]).round(15))
def Ry(theta):
return mat(mat([[cos(theta), 0, -sin(theta)],
[ 0 , 1, 0 ],
[sin(theta), 0, cos(theta) ]]).round(15))
def Rz(theta):
return mat(mat([[cos(theta), -sin(theta), 0],
[sin(theta), cos(theta) , 0],
[ 0 , 0 , 1]]).round(15))
#returns a 2d projection matrix,
def proj2d(p):
return mat(eye(2,3)*p)
#tuple into vector
def vector(tuple):
return transpose(mat(list(tuple)))
#updates position of the 3D point in function of the x,y,z angles
def position(pts3d,anglex,angley,anglez):
for i in range(len(pts3d)):
pts3d[i] = (float((Rx(anglex) * vector(pts3d[i]))[0]),
float((Rx(anglex) * vector(pts3d[i]))[1]),
float((Rx(anglex) * vector(pts3d[i]))[2]))
pts3d[i] = (float((Ry(angley) * vector(pts3d[i]))[0]),
float((Ry(angley) * vector(pts3d[i]))[1]),
float((Ry(angley) * vector(pts3d[i]))[2]))
pts3d[i] = (float((Rz(anglez) * vector(pts3d[i]))[0]),
float((Rz(anglez) * vector(pts3d[i]))[1]),
float((Rz(anglez) * vector(pts3d[i]))[2]))
#makes a projection of the 3d points on the 2d screen
def projected(pts3d):
pts2d = []
for i in pts3d:
pts2d.append((float((proj2d(30+0.75*i[2]) * vector(i))[0]),
float((proj2d(30+0.75*i[2]) * vector(i))[1])))
return pts2d
#displays dots
def dots(canvas,points):
for i in points:
canvas.create_oval(H/2+5+i[0],H/2+5+i[1],H/2-5+i[0],H/2-5+i[1],fill = 'white')
#displays vertices
def connect(canvas,vertics,points):
for i in vertics:
canvas.create_line(H/2+points[int(i[0])][0],H/2+points[int(i[0])][1],H/2+points[int(i[1])][0],H/2+points[int(i[1])][1],width = 2,fill = 'white')
#what I should modify, I guess: it's the funtion that displays the faces of the object
def face(canvas,faces,points,colors):
for i in range(len(faces)):
coordsface = ()
for j in faces[i]:
coordsface += (H/2+points[int(j)][0],H/2+points[int(j)][1])
canvas.create_polygon(coordsface,fill = colors[i])
#major functions, updates position each time interval(delay)
def updateposition(self,H,canvas,points,vertics,faces,clrfc,delai,domegax,domegay,domegaz):
canvas.delete('all')
y,x = self.winfo_pointerx() - self.winfo_rootx() - H/2, self.winfo_pointery() - self.winfo_rooty() - H/2
if abs(x) >= H/2 or abs(y) >= H/2: x,y = 0,0
domegax -= 0.00001*(x)
domegay -= 0.00001*(y)
position(points,domegax,domegay,domegaz)
if affpts == 'y':
dots(canvas,projected(points))
if affart == 'y':
connect(canvas,vertics,projected(points))
if afffac == 'y':
face(canvas,faces,projected(points),clrfc)
self.after(delai,updateposition,self,H,canvas,points,vertics,faces,clrfc,delai,domegax,domegay,domegaz)
## cube
def pts3Dcube():
#points
a = ( L/2, L/2, L/2)
b = ( L/2, L/2,-L/2)
c = ( L/2,-L/2, L/2)
d = ( L/2,-L/2,-L/2)
e = (-L/2, L/2, L/2)
f = (-L/2, L/2,-L/2)
g = (-L/2,-L/2, L/2)
h = (-L/2,-L/2,-L/2)
pts3d = [a,b,c,d,e,f,g,h]
#vertices
aretes = []
for i in [0,2,4,6]:
aretes.append(str(i)+str(i+1))
for i in [0,1,4,5]:
aretes.append(str(i)+str(i+2))
for i in [0,1,2,3]:
aretes.append(str(i)+str(i+4))
#faces
faces = ['0132','4576','0154','2376','1375','0264']
clrfc = ['green','red','yellow','blue','orange','white']
return pts3d, aretes, faces, clrfc
## initial conditions
L = 5
H = 600
delai = 5
self = Tk()
canvas = Canvas(self,height = H,width = H,bg = 'gray13')
canvas.pack()
objet = pts3Dcube() #object choice
domegax = 0.0
domegay = 0.0
domegaz = 0.0
#initial rotation angles
iomegax = 0
iomegay = 0
iomegaz = 0
#displaying points, vertices, faces or not
affpts = 'y'
affart = 'y'
afffac = 'y'
position(objet[0],iomegax,iomegay,iomegaz) #initial rotation
updateposition(self,H,canvas,objet[0],objet[1],objet[2],objet[3],delai,domegax,domegay,domegaz) # dynamic rotation
if any of you have an idea, please comment it or something, I'm lost.
Thanks!

Related

Function to draw building with windows and doors

I'm creating a function to draw a office tower:
windows are 20 pixels square
the gap between the windows is 10 pixels
the door is 20 pixels wide, 50 pixels tall, and orange
My code doesn't draw it properly:
from graphics import *
from random import *
def add_window(win, nH, nV):
w, h = win.getWidth(), win.getHeight()
rects = []
for x in range(nH):
rects.append([])
for y in range(nV):
r = Rectangle(Point( x *w//nH, y *h//vV),
Point((x+1)*w//nH, (y+1)*h//nV))
window = [ r,
True,
[ 'red', 'green' ]
]
rects[x].append(window)
rects[x][y][0].draw(win)
rects[x][y][0].setOutline('blue')
color = window[2][randint[0,1]]
rects[x][y][0].setFill(color)
return rects
WIN_W, WIN_H = 500, 400
#Top left coner of the building
BLDG_LEFT, BLDG_TOP = 50, 50
#How many floors, how many windows perfloor, window digit and gap
FLOORS, WIN_FLR, WIN_SZ, GAP = 10, 5, 20, 5
win = None
#Syntax : window[x][y]
# [0] : Rectangle() object
# [1] : True/False
windows = []
#--------------------------------------------------------------------
def draw_window(x, y):
global windows
windows = []
left = BLDG_LEFT + GAP + x* (WIN_SZ+GAP)
top = BLDG_TOP + GAP + y* (WIN_SZ+GAP)
r = Rectangle(Point( x *WIN_SZ+GAP, y *(WIN_SZ+GAP)),
Point((x+1)*WIN_SZ+GAP, (y+1)*(WIN_SZ+GAP)))
windows[x][y].append(r)
bit = randint(0,1)
windows[x][y].append(bool(bit))
windows[x][y][0].setFill(COLORS[bit])
windows[x][y][0].draw(win)
def draw_windows():
for i in range(WIN_FLR):
windows.append([])
for j in range(FLOORS):
windows[i].append([])
draw_window(i, j)
def office_tower():
global win
win = GraphWin("OFFICE TOWER", WIN_W, WIN_H)
draw_window(1, 1)
while True:
pt = win.getmouse()
if pt.x < 10 and pt.y < 10:
break
# windows coordinates
x = int((pt.x - BLDG_LEFT - GAP)/(WIN_SZ + GAP))
y = int((pt.y - BLDG_TOP - GAP)/(WIN_SZ + GAP))
print(str((pt.x, pt.y)) + ' --> ' + str((x, y)))
windows[x][y][1] = netwindows[x][y][1]
windows[x][y][0].setFill(COLORS[windows[x][y][1]])
def draw_building():
global windows
win = GraphWin("OFFICE TOWER", WIN_W, WIN_H)
N_H, N_V = 5, 10
while True:
pt = win.getMouse()
m_x, m_y = pt.getX(), pt.getY()
# Grid coordinates:
g_x = m_x // (WIN_W//N_H)
g_y = m_y // (WIN_H//N_V)
# For development purposes:
if m_x < 10 and m_y < 10:
break
This seems to be the worst virtual high-rise disaster since Irwin Allen's "Towering Inferno". There appear to be at least two different incomplete implementations in the file where most of the functions are never called and the code draws nothing. Here's my salvage job on the ruins:
from random import randint
from graphics import *
GRAPHIC_WINDOW_WIDTH, GRAPHIC_WINDOW_HEIGHT = 500, 400
# Top left coner of the building
BUILDING_LEFT, BUILDING_TOP = 50, 50
COLORS = ['gray25', 'gray85'] # lights off, lights on
# How many BUILDING_FLOORS, how many windows per floor, window size and gap
BUILDING_FLOORS, WINDOWS_PER_FLOOR, WINDOW_SIZE, WINDOW_GAP = 10, 5, 20, 5
WINDOW_FRAME = WINDOW_SIZE + WINDOW_GAP
# Syntax : window[x][y]
# [0] : Rectangle() object
# [1] : True/False
#--------------------------------------------------------------------
def draw_window(row, column, left, top):
r = Rectangle(Point(left + column * WINDOW_FRAME, top + row * WINDOW_FRAME), \
Point(left + (column + 1) * WINDOW_FRAME, top + (row + 1) * WINDOW_FRAME))
bit = bool(randint(0, 1))
r.setFill(COLORS[bit])
r.draw(win)
windows[row][column] = [r, bit]
def draw_windows(left, top):
for row in range(BUILDING_FLOORS):
windows.append([])
for column in range(WINDOWS_PER_FLOOR):
windows[row].append(None)
draw_window(row, column, left, top)
def office_tower():
draw_windows(BUILDING_LEFT, BUILDING_TOP)
while True:
pt = win.getMouse()
if pt.x < BUILDING_LEFT and pt.y < BUILDING_TOP:
break # clean exit stategy
# windows coordinates
column = int((pt.x - BUILDING_LEFT - WINDOW_GAP) / WINDOW_FRAME)
row = int((pt.y - BUILDING_TOP - WINDOW_GAP) / WINDOW_FRAME)
# print((pt.x, pt.y), '-->', (row, column))
windows[row][column][1] = not windows[row][column][1]
windows[row][column][0].setFill(COLORS[windows[row][column][1]])
win = GraphWin('OFFICE TOWER', GRAPHIC_WINDOW_WIDTH, GRAPHIC_WINDOW_HEIGHT)
windows = []
office_tower()
win.close()
This draws the following building:
Where you can click on the windows to toggle their color. (I chose an 'on' / 'off' motif.) Clicking to the upper left of the building exits.

What is wrong with my Implementation of 4th Order runge kutta in python for nonholonomic constraints?

I am trying to implement 4th order Runge Kutta for nonholonomic motion for car-like robots.
I don't know what I am doing wrong,essentially I am passing +-Pi/4 to calculate hard left and right turns to get different trajectories.
But no matter if I pass +pi/4 or -pi/4 to it, I get the same answer.
I cannot figure out what I am doing wrong.
The constraint equations that I am using are:
thetadot = (s/L)*tan(phi)
xdot = s*cos(theta)
ydot = s*sin(theta)
Where s is the speed and L is the length of the car like robot.
#! /usr/bin/env python
import sys, random, math, pygame
from pygame.locals import *
from math import sqrt,cos,sin,atan2,tan
import numpy as np
import matplotlib.pyplot as plt
XDIM = 640
YDIM = 480
WINSIZE = [XDIM, YDIM]
PHI = 45
s = 0.5
white = 255, 240, 200
black = 20, 20, 40
red = 255, 0, 0
green = 0, 255, 0
blue = 0, 0, 255
cyan = 0,255,255
pygame.init()
screen = pygame.display.set_mode(WINSIZE)
X = XDIM/2
Y = YDIM/2
THETA = 45
def main():
nodes = []
nodes.append(Node(XDIM/2.0,YDIM/2.0,0.0))
plt.plot(runge_kutta(nodes[0], (3.14/4))) #Hard Left turn
plt.plot(runge_kutta(nodes[0], 0)) #Straight ahead
plt.plot(runge_kutta(nodes[0], -(3.14/4))) #Hard Right turn
plt.show()
class Node:
x = 0
y = 0
theta = 0
distance=0
parent=None
def __init__(self,xcoord, ycoord, theta):
self.x = xcoord
self.y = ycoord
self.theta = theta
def rk4(f, x, y, n):
x0 = y0 = 0
vx = [0]*(n + 1)
vy = [0]*(n + 1)
h = 0.8
vx[0] = x = x0
vy[0] = y = y0
for i in range(1, n + 1):
k1 = h*f(x, y)
k2 = h*f(x + 0.5*h, y + 0.5*k1)
k3 = h*f(x + 0.5*h, y + 0.5*k2)
k4 = h*f(x + h, y + k3)
vx[i] = x = x0 + i*h
vy[i] = y = y + (k1 + k2 + k2 + k3 + k3 + k4)/6
print "1"
print vy
return vy
def fun1(x,y):
x = (0.5/2)*tan(y)
print "2"
print x
return x
def fun2(x,y):
x = 0.5*cos(y)
print "3"
print x
return x
def fun3(x,y):
x = 0.5*sin(y)
print "4"
print x
return x
def runge_kutta(p, phi):
x1 = p.x
y1 = p.y
theta1 = p.theta
fi = phi
for i in range(0,5):
x2 = rk4(fun2, x1, theta1, 5)
y2 = rk4(fun3, y1, theta1, 5)
theta2 = rk4(fun1, theta1 ,fi, 5)
theta1 = theta2
print "5"
print zip(x2,y2)
return zip(x2,y2)
# if python says run, then we should run
if __name__ == '__main__':
main()
running = True
while running:
for event in pygame.event.get():
if event.type == pygame.QUIT:
running = False
I can't really say much about the algorithm, but the way you set up our rk4 function, the x, and y arguments will never have any effect:
def rk4(f, x, y, n):
x0 = y0 = 0 # x0 and y0 will both be 0 after this
vx = [0]*(n + 1)
vy = [0]*(n + 1)
h = 0.8
vx[0] = x = x0 # now x will be 0
vy[0] = y = y0 # and y will be 0 too
...
The rest of the function will use x=0 and y=0 in any case.
Also, I don't know if that's intentional, but the other functions fun1, fun2 and fun3 don't ever use the parameter passed as x, they only use y. They change x locally, but that won't reflect outside the function.

spiraling hexagonal grid in python

I want to create a hexagonal grid using XYZ coordinates that is constructed in a spiraling pattern. This is my current code, which produces a grid depicted by the red arrows below. My problem area is circled. Rather than going from [-1,0,1] to [0,-2,2] I need to move from [-1,0,1] to [-1,-1,2] (following the blue line).
The complete code appears below the hash line- I am creating the visualization in Blender 2.65a
radius = 11 # determines size of field
deltas = [[1,0,-1],[0,1,-1],[-1,1,0],[-1,0,1],[0,-1,1],[1,-1,0]]
hex_coords = []
for r in range(radius):
x = 0
y = -r
z = +r
points = x,y,z
hex_coords.append(points)
for j in range(6):
if j==5:
num_of_hexas_in_edge = r-1
else:
num_of_hexas_in_edge = r
for i in range(num_of_hexas_in_edge):
x = x+deltas[j][0]
y = y+deltas[j][1]
z = z+deltas[j][2]
plot = x,y,z
hex_coords.append(plot)
-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-#-
import bpy
FOXP2 = '''
CTTGAACCTTTGTCACCCCTCACGTTGCACACCAAAGACATACCCTAGTGATTAAATGCTGATTTTGTGT
ACGATTGTCCACGGACGCCAAAACAATCACAGAGCTGCTTGATTTGTTTTAATTACCAGCACAAAATGCC
CAATTCCTCCTCGACTACCTCCTCCAACACTTCCAAAGCATCACCACCAATAACTCATCATTCCATAGTG
AATGGACAGTCTTCAGTTCTAAGTGCAAGACGAGACAGCTCGTCACATGAGGAGACTGGGGCCTCTCACA
CTCTCTATGGCCATGGAGTTTGCAAATGGCCAGGCTGTGAAAGCATTTGTGAAGATTTTGGACAGTTTTT
AAAGCACCTTAACAATGAACACGCATTGGATGACCGAAGCACTGCTCAGTGTCGAGTGCAAATGCAGGTG
GTGCAACAGTTAGAAATACAGCTTTCTAAAGAACGCGAACGTCTTCAAGCAATGATGACCCACTTGCACA
'''
set_size = len(FOXP2)
def makeMaterial(name, diffuse, specular, alpha):
mat = bpy.data.materials.new(name)
mat.diffuse_color = diffuse
mat.diffuse_shader = 'LAMBERT'
mat.diffuse_intensity = 1.0
mat.specular_color = specular
mat.specular_shader = 'COOKTORR'
mat.specular_intensity = 0.5
mat.alpha = alpha
mat.ambient = 1
return mat
def setMaterial(ob, mat):
me = ob.data
me.materials.append(mat)
# Create four materials
red = makeMaterial('Red', (1,0,0), (0,0,0), .5)
blue = makeMaterial('BlueSemi', (0,0,1), (0,0,0), 0.5)
green = makeMaterial('Green',(0,1,0), (0,0,0), 0.5)
yellow = makeMaterial('Yellow',(1,1,0), (0,0,0), 0.5)
black = makeMaterial('Black',(0,0,0), (0,0,0), 0.5)
white = makeMaterial('White',(1,1,1), (0,0,0), 0.5)
def make_sphere(volume, position):
create = bpy.ops.mesh.primitive_uv_sphere_add
create(size=volume, location=position)
# Builds a list of coordinate points
radius = 11
deltas = [[1,0,-1],[0,1,-1],[-1,1,0],[-1,0,1],[0,-1,1],[1,-1,0]]
hex_coords = []
for r in range(radius):
x = 0
y = -r
z = +r
points = x,y,z
hex_coords.append(points)
for j in range(6):
if j==5:
num_of_hexas_in_edge = r-1
else:
num_of_hexas_in_edge = r
for i in range(num_of_hexas_in_edge):
x = x+deltas[j][0]
y = y+deltas[j][1]
z = z+deltas[j][2]
plot = x,y,z
hex_coords.append(plot)
# Color-codes sequence and appends to color_array
color_array = []
for x in FOXP2:
if x == 'A':
color_array.append(1)
elif x == 'T':
color_array.append(1)
elif x == 'C':
color_array.append(0)
elif x == 'G':
color_array.append(0)
else:
pass
# Pulls from sequence data and applies color to sphere
# Positions sphere to coordinates
# Pulls from color_code and applies color scheme to sphere object
for x in color_array:
if x =='RED':
coord_tuple = hex_coords.pop(0)
make_sphere(1, coord_tuple)
setMaterial(bpy.context.object, red)
elif x =='GREEN':
coord_tuple = hex_coords.pop(0)
make_sphere(1, coord_tuple)
setMaterial(bpy.context.object, green)
elif x =='BLUE':
coord_tuple = hex_coords.pop(0)
make_sphere(1, coord_tuple)
setMaterial(bpy.context.object, blue)
elif x =='YELLOW':
coord_tuple = hex_coords.pop(0)
make_sphere(1, coord_tuple)
setMaterial(bpy.context.object, yellow)
else:
pass

Mesh Generation for Computational Science in Python

I have a need for a Python module/package that provides a mesh on which I can do computational science? I am not doing graphics, so I don't think the blender package is what I want.
Does anyone know of a good package?
The most useful packages out there are perhaps
mshr,
pygalmesh,
dmsh,
pygmsh, and
MeshPy,
meshzoo.
In addition, there is optimesh for improving the quality of any mesh.
(Disclaimer: I'm the author of pygmsh, pygalmesh, dmsh, meshzoo, and optimesh.)
If you're trying to solve FE or CFD style equations on a mesh you can use MeshPy in 2 and 3 dimensions. Meshpy is a nice wrapper around the existing tools tetgen and triangle.
If you're looking for more typical graphics style meshes, there was an interesting talk at PyCon 2011 "Algorithmic Generation of OpenGL Geometry", which described a pragmatic approach to procedural mesh generation. The code from the presentation is available online
If you're interested in reconstruction of surfaces from data, you can't go past the Standford 3D Scanning Repository, home of the Stanford Bunny
Edit:
A dependancy free alternative may be to use something like gmsh, which is platform independent, and uses similar tools to meshpy in its back-end.
I recommend using NumPy (especially if you've used MATLAB before). Many computational scientists / mechanical engineers working in python might agree, but I'm biased as it found it's way into much of the last year of my research. It's part of SciPy: http://numpy.scipy.org/
I was fond of numpy.linspace(a,b,N) which makes an N length vector of equally spaced values from a to b. You can use numpy.ndarray to make a N x M matrix, or if you want 2D arrays use numpy.meshgrid.
Here is code adapted from Kardontchik's port,
import numpy as np
from numpy import pi as pi
from scipy.spatial import Delaunay
import matplotlib.pylab as plt
from scipy.optimize import fmin
import matplotlib.pylab as plt
def ktrimesh(p,bars,pflag=0):
# create the (x,y) data for the plot
xx1 = p[bars[:,0],0]; yy1 = p[bars[:,0],1]
xx2 = p[bars[:,1],0]; yy2 = p[bars[:,1],1]
xmin = np.min(p[:,0])
xmax = np.max(p[:,0])
ymin = np.min(p[:,1])
ymax = np.max(p[:,1])
xmin = xmin - 0.05*(xmax - xmin)
xmax = xmax + 0.05*(xmax - xmin)
ymin = ymin - 0.05*(ymax - ymin)
ymax = ymax + 0.05*(ymax - ymin)
plt.figure()
for i in range(len(xx1)):
xp = np.array([xx1[i],xx2[i]])
yp = np.array([yy1[i],yy2[i]])
plt.plot(xmin,ymin,'.',xmax,ymax,'.',markersize=0.1)
plt.plot(xp,yp,'k')
plt.axis('equal')
if pflag == 0:
stitle = 'Triangular Mesh'
if pflag == 1:
stitle = 'Visual Boundary Integrity Check'
#plt.title('Triangular Mesh')
plt.title(stitle)
plt.xlabel('x')
plt.ylabel('y')
plt.show()
return 1
def ccw_tri(p,t):
"""
orients all the triangles counterclockwise
"""
# vector A from vertex 0 to vertex 1
# vector B from vertex 0 to vertex 2
A01x = p[t[:,1],0] - p[t[:,0],0]
A01y = p[t[:,1],1] - p[t[:,0],1]
B02x = p[t[:,2],0] - p[t[:,0],0]
B02y = p[t[:,2],1] - p[t[:,0],1]
# if vertex 2 lies to the left of vector A the component z of
# their vectorial product A^B is positive
Cz = A01x*B02y - A01y*B02x
a = t[np.where(Cz<0)]
b = t[np.where(Cz>=0)]
a[:,[1,2]] = a[:,[2,1]]
t = np.concatenate((a, b))
return t
def triqual_flag(p,t):
# a(1,0), b(2,0), c(2,1)
a = np.sqrt((p[t[:,1],0] - p[t[:,0],0])**2 + (p[t[:,1],1] - p[t[:,0],1])**2)
b = np.sqrt((p[t[:,2],0] - p[t[:,0],0])**2 + (p[t[:,2],1] - p[t[:,0],1])**2)
c = np.sqrt((p[t[:,2],0] - p[t[:,1],0])**2 + (p[t[:,2],1] - p[t[:,1],1])**2)
A = 0.25*np.sqrt((a+b+c)*(b+c-a)*(a+c-b)*(a+b-c))
R = 0.25*(a*b*c)/A
r = 0.5*np.sqrt( (a+b-c)*(b+c-a)*(a+c-b)/(a+b+c) )
q = 2.0*(r/R)
min_edge = np.minimum(np.minimum(a,b),c)
min_angle_deg = (180.0/np.pi)*np.arcsin(0.5*min_edge/R)
min_q = np.min(q)
min_ang = np.min(min_angle_deg)
return min_q, min_ang
def triqual(p,t,fh,qlim=0.2):
# a(1,0), b(2,0), c(2,1)
a = np.sqrt((p[t[:,1],0] - p[t[:,0],0])**2 + (p[t[:,1],1] - p[t[:,0],1])**2)
b = np.sqrt((p[t[:,2],0] - p[t[:,0],0])**2 + (p[t[:,2],1] - p[t[:,0],1])**2)
c = np.sqrt((p[t[:,2],0] - p[t[:,1],0])**2 + (p[t[:,2],1] - p[t[:,1],1])**2)
A = 0.25*np.sqrt((a+b+c)*(b+c-a)*(a+c-b)*(a+b-c))
R = 0.25*(a*b*c)/A
r = 0.5*np.sqrt( (a+b-c)*(b+c-a)*(a+c-b)/(a+b+c) )
q = 2.0*(r/R)
pmid = (p[t[:,0]] + p[t[:,1]] + p[t[:,2]])/3.0
hmid = fh(pmid)
Ah = A/hmid
Anorm = Ah/np.mean(Ah)
min_edge = np.minimum(np.minimum(a,b),c)
min_angle_deg = (180.0/np.pi)*np.arcsin(0.5*min_edge/R)
plt.figure()
plt.subplot(3,1,1)
plt.hist(q)
plt.title('Histogram;Triangle Statistics:q-factor,Minimum Angle and Area')
plt.subplot(3,1,2)
plt.hist(min_angle_deg)
plt.ylabel('Number of Triangles')
plt.subplot(3,1,3)
plt.hist(Anorm)
plt.xlabel('Note: for equilateral triangles q = 1 and angle = 60 deg')
plt.show()
indq = np.where(q < qlim) # indq is a tuple: len(indq) = 1
if list(indq[0]) != []:
print ('List of triangles with q < %5.3f and the (x,y) location of their nodes' % qlim)
print ('')
print ('q t[i] t[nodes] [x,y][0] [x,y][1] [x,y][2]')
for i in indq[0]:
print ('%.2f %4d [%4d,%4d,%4d] [%+.2f,%+.2f] [%+.2f,%+.2f] [%+.2f,%+.2f]' % \
(q[i],i,t[i,0],t[i,1],t[i,2],p[t[i,0],0],p[t[i,0],1],p[t[i,1],0],p[t[i,1],1],p[t[i,2],0],p[t[i,2],1]))
print ('')
# end of detailed data on worst offenders
return q,min_angle_deg,Anorm
class Circle:
def __init__(self,xc,yc,r):
self.xc, self.yc, self.r = xc, yc, r
def __call__(self,p):
xc, yc, r = self.xc, self.yc, self.r
d = np.sqrt((p[:,0] - xc)**2 + (p[:,1] - yc)**2) - r
return d
class Rectangle:
def __init__(self,x1,x2,y1,y2):
self.x1, self.x2, self.y1, self.y2 = x1,x2,y1,y2
def __call__(self,p):
x1,x2,y1,y2 = self.x1, self.x2, self.y1, self.y2
d1 = p[:,1] - y1 # if p inside d1 > 0
d2 = y2 - p[:,1] # if p inside d2 > 0
d3 = p[:,0] - x1 # if p inside d3 > 0
d4 = x2 - p[:,0] # if p inside d4 > 0
d = -np.minimum(np.minimum(np.minimum(d1,d2),d3),d4)
return d
class Polygon:
def __init__(self,verts):
self.verts = verts
def __call__(self,p):
verts = self.verts
# close the polygon
cverts = np.zeros((len(verts)+1,2))
cverts[0:-1] = verts
cverts[-1] = verts[0]
# initialize
inside = np.zeros(len(p))
dist = np.zeros(len(p))
Cz = np.zeros(len(verts)) # z-components of the vectorial products
dist_to_edge = np.zeros(len(verts))
in_ref = np.ones(len(verts))
# if np.sign(Cz) == in_ref then point is inside
for j in range(len(p)):
Cz = (cverts[1:,0] - cverts[0:-1,0])*(p[j,1] - cverts[0:-1,1]) - \
(cverts[1:,1] - cverts[0:-1,1])*(p[j,0] - cverts[0:-1,0])
dist_to_edge = Cz/np.sqrt( \
(cverts[1:,0] - cverts[0:-1,0])**2 + \
(cverts[1:,1] - cverts[0:-1,1])**2)
inside[j] = int(np.array_equal(np.sign(Cz),in_ref))
dist[j] = (1 - 2*inside[j])*np.min(np.abs(dist_to_edge))
return dist
class Union:
def __init__(self,fd1,fd2):
self.fd1, self.fd2 = fd1, fd2
def __call__(self,p):
fd1,fd2 = self.fd1, self.fd2
d = np.minimum(fd1(p),fd2(p))
return d
class Diff:
def __init__(self,fd1,fd2):
self.fd1, self.fd2 = fd1, fd2
def __call__(self,p):
fd1,fd2 = self.fd1, self.fd2
d = np.maximum(fd1(p),-fd2(p))
return d
class Intersect:
def __init__(self,fd1,fd2):
self.fd1, self.fd2 = fd1, fd2
def __call__(self,p):
fd1,fd2 = self.fd1, self.fd2
d = np.maximum(fd1(p),fd2(p))
return d
class Protate:
def __init__(self,phi):
self.phi = phi
def __call__(self,p):
phi = self.phi
c = np.cos(phi)
s = np.sin(phi)
temp = np.copy(p[:,0])
rp = np.copy(p)
rp[:,0] = c*p[:,0] - s*p[:,1]
rp[:,1] = s*temp + c*p[:,1]
return rp
class Pshift:
def __init__(self,x0,y0):
self.x0, self.y0 = x0,y0
def __call__(self,p):
x0, y0 = self.x0, self.y0
p[:,0] = p[:,0] + x0
p[:,1] = p[:,1] + y0
return p
def Ellipse_dist_to_minimize(t,p,xc,yc,a,b):
x = xc + a*np.cos(t) # coord x of the point on the ellipse
y = yc + b*np.sin(t) # coord y of the point on the ellipse
dist = (p[0] - x)**2 + (p[1] - y)**2
return dist
class Ellipse:
def __init__(self,xc,yc,a,b):
self.xc, self.yc, self.a, self.b = xc, yc, a, b
self.t, self.verts = self.pick_points_on_shape()
def pick_points_on_shape(self):
xc, yc, a, b = self.xc, self.yc, self.a, self.b
c = np.array([xc,yc])
t = np.linspace(0,(7.0/4.0)*pi,8)
verts = np.zeros((8,2))
verts[:,0] = c[0] + a*np.cos(t)
verts[:,1] = c[1] + b*np.sin(t)
return t, verts
def inside_ellipse(self,p):
xc, yc, a, b = self.xc, self.yc, self.a, self.b
c = np.array([xc,yc])
r, phase = self.rect_to_polar(p-c)
r_ellipse = self.rellipse(phase)
in_ref = np.ones(len(p))
inside = 0.5 + 0.5*np.sign(r_ellipse-r)
return inside
def rect_to_polar(self,p):
r = np.sqrt(p[:,0]**2 + p[:,1]**2)
phase = np.arctan2(p[:,1],p[:,0])
# note: np.arctan2(y,x) order; phase in +/- pi (+/- 180deg)
return r, phase
def rellipse(self,phi):
a, b = self.a, self.b
r = a*b/np.sqrt((b*np.cos(phi))**2 + (a*np.sin(phi))**2)
return r
def find_closest_vertex(self,point):
t, verts = self.t, self.verts
dist = np.zeros(len(t))
for i in range(len(t)):
dist[i] = (point[0] - verts[i,0])**2 + (point[1] - verts[i,1])**2
ind = np.argmin(dist)
t0 = t[ind]
return t0
def __call__(self,p):
xc, yc, a, b = self.xc, self.yc, self.a, self.b
t, verts = self.t, self.verts
dist = np.zeros(len(p))
inside = self.inside_ellipse(p)
for j in range(len(p)):
t0 = self.find_closest_vertex(p[j]) # initial guess to minimizer
opt = fmin(Ellipse_dist_to_minimize,t0, \
args=(p[j],xc,yc,a,b),full_output=1,disp=0)
# add full_output=1 so we can retrieve the min dist(squared)
# (2nd argument of opt array, 1st argument is the optimum t)
min_dist = np.sqrt(opt[1])
dist[j] = min_dist*(1 - 2*inside[j])
return dist
def distmesh(fd,fh,h0,xmin,ymin,xmax,ymax,pfix,ttol=0.1,dptol=0.001,Iflag=1,qmin=1.0):
geps = 0.001*h0; deltat = 0.2; Fscale = 1.2
deps = h0 * np.sqrt(np.spacing(1))
random_seed = 17
h0x = h0; h0y = h0*np.sqrt(3)/2 # to obtain equilateral triangles
Nx = int(np.floor((xmax - xmin)/h0x))
Ny = int(np.floor((ymax - ymin)/h0y))
x = np.linspace(xmin,xmax,Nx)
y = np.linspace(ymin,ymax,Ny)
# create the grid in the (x,y) plane
xx,yy = np.meshgrid(x,y)
xx[1::2] = xx[1::2] + h0x/2.0 # shifts even rows by h0x/2
p = np.zeros((np.size(xx),2))
p[:,0] = np.reshape(xx,np.size(xx))
p[:,1] = np.reshape(yy,np.size(yy))
p = np.delete(p,np.where(fd(p) > geps),axis=0)
np.random.seed(random_seed)
r0 = 1.0/fh(p)**2
p = np.concatenate((pfix,p[np.random.rand(len(p))<r0/max(r0),:]))
pold = np.inf
Num_of_Delaunay_triangulations = 0
Num_of_Node_movements = 0 # dp = F*dt
while (1):
Num_of_Node_movements += 1
if Iflag == 1 or Iflag == 3: # Newton flag
print ('Num_of_Node_movements = %3d' % (Num_of_Node_movements))
if np.max(np.sqrt(np.sum((p - pold)**2,axis = 1))) > ttol:
Num_of_Delaunay_triangulations += 1
if Iflag == 1 or Iflag == 3: # Delaunay flag
print ('Num_of_Delaunay_triangulations = %3d' % \
(Num_of_Delaunay_triangulations))
pold = p
tri = Delaunay(p) # instantiate a class
t = tri.vertices
pmid = (p[t[:,0]] + p[t[:,1]] + p[t[:,2]])/3.0
t = t[np.where(fd(pmid) < -geps)]
bars = np.concatenate((t[:,[0,1]],t[:,[0,2]], t[:,[1,2]]))
bars = np.unique(np.sort(bars),axis=0)
if Iflag == 4:
min_q, min_angle_deg = triqual_flag(p,t)
print ('Del iter: %3d, min q = %5.2f, min angle = %3.0f deg' \
% (Num_of_Delaunay_triangulations, min_q, min_angle_deg))
if min_q > qmin:
break
if Iflag == 2 or Iflag == 3:
ktrimesh(p,bars)
# move mesh points based on bar lengths L and forces F
barvec = p[bars[:,0],:] - p[bars[:,1],:]
L = np.sqrt(np.sum(barvec**2,axis=1))
hbars = 0.5*(fh(p[bars[:,0],:]) + fh(p[bars[:,1],:]))
L0 = hbars*Fscale*np.sqrt(np.sum(L**2)/np.sum(hbars**2))
F = np.maximum(L0-L,0)
Fvec = np.column_stack((F,F))*(barvec/np.column_stack((L,L)))
Ftot = np.zeros((len(p),2))
n = len(bars)
for j in range(n):
Ftot[bars[j,0],:] += Fvec[j,:] # the : for the (x,y) components
Ftot[bars[j,1],:] -= Fvec[j,:]
# force = 0 at fixed points, so they do not move:
Ftot[0: len(pfix),:] = 0
# update the node positions
p = p + deltat*Ftot
# bring outside points back to the boundary
d = fd(p); ix = d > 0 # find points outside (d > 0)
dpx = np.column_stack((p[ix,0] + deps,p[ix,1]))
dgradx = (fd(dpx) - d[ix])/deps
dpy = np.column_stack((p[ix,0], p[ix,1] + deps))
dgrady = (fd(dpy) - d[ix])/deps
p[ix,:] = p[ix,:] - np.column_stack((dgradx*d[ix], dgrady*d[ix]))
# termination criterium: all interior nodes move less than dptol:
if max(np.sqrt(np.sum(deltat*Ftot[d<-geps,:]**2,axis=1))/h0) < dptol:
break
final_tri = Delaunay(p) # another instantiation of the class
t = final_tri.vertices
pmid = (p[t[:,0]] + p[t[:,1]] + p[t[:,2]])/3.0
# keep the triangles whose geometrical center is inside the shape
t = t[np.where(fd(pmid) < -geps)]
bars = np.concatenate((t[:,[0,1]],t[:,[0,2]], t[:,[1,2]]))
# delete repeated bars
#bars = unique_rows(np.sort(bars))
bars = np.unique(np.sort(bars),axis=0)
# orient all the triangles counterclockwise (ccw)
t = ccw_tri(p,t)
# graphical output of the current mesh
ktrimesh(p,bars)
triqual(p,t,fh)
return p,t,bars
def boundary_bars(t):
# create the bars (edges) of every triangle
bars = np.concatenate((t[:,[0,1]],t[:,[0,2]], t[:,[1,2]]))
# sort all the bars
data = np.sort(bars)
# find the bars that are not repeated
Delaunay_bars = dict()
for row in data:
row = tuple(row)
if row in Delaunay_bars:
Delaunay_bars[row] += 1
else:
Delaunay_bars[row] = 1
# return the keys of Delaunay_bars whose value is 1 (non-repeated bars)
bbars = []
for key in Delaunay_bars:
if Delaunay_bars[key] == 1:
bbars.append(key)
bbars = np.asarray(bbars)
return bbars
def plot_shapes(xc,yc,r):
# circle for plotting
t_cir = np.linspace(0,2*pi)
x_cir = xc + r*np.cos(t_cir)
y_cir = yc + r*np.sin(t_cir)
plt.figure()
plt.plot(x_cir,y_cir)
plt.grid()
plt.title('Shapes')
plt.xlabel('x')
plt.ylabel('y')
plt.axis('equal')
#plt.show()
return
plt.close('all')
xc = 0; yc = 0; r = 1.0
x1,y1 = -1.0,-2.0
x2,y2 = 2.0,3.0
plot_shapes(xc,yc,r)
xmin = -1.5; ymin = -1.5
xmax = 1.5; ymax = 1.5
h0 = 0.4
pfix = np.zeros((0,2)) # null 2D array, no fixed points provided
fd = Circle(xc,yc,r)
fh = lambda p: np.ones(len(p))
p,t,bars = distmesh(fd,fh,h0,xmin,ymin,xmax,ymax,pfix,Iflag=4)

Creating a tiled map with blender

I'm looking at creating map tiles based on a 3D model made in blender,
The map is 16 x 16 in blender.
I've got 4 different zoom levels and each tile is 100 x 100 pixels. The entire map at the most zoomed out level is 4 x 4 tiles constructing an image of 400 x 400.
The most zoomed in level is 256 x 256 obviously constructing an image of 25600 x 25600
What I need is a script for blender that can create the tiles from the model.
I've never written in python before so I've been trying to adapt a couple of the scripts which are already there.
So far I've come up with a script, but it doesn't work very well. I'm having real difficulties getting the tiles to line up seamlessly. I'm not too concerned about changing the height of the camera as I can always create the same zoomed out tiles at 6400 x 6400 images and split the resulting images into the correct tiles.
Here is what I've got so far...
#!BPY
"""
Name: 'Export Map Tiles'
Blender: '242'
Group: 'Export'
Tip: 'Export to Map'
"""
import Blender
from Blender import Scene,sys
from Blender.Scene import Render
def init():
thumbsize = 200
CameraHeight = 4.4
YStart = -8
YMove = 4
XStart = -8
XMove = 4
ZoomLevel = 1
Path = "/Images/Map/"
Blender.drawmap = [thumbsize,CameraHeight,YStart,YMove,XStart,XMove,ZoomLevel,Path]
def show_prefs():
buttonthumbsize = Blender.Draw.Create(Blender.drawmap[0]);
buttonCameraHeight = Blender.Draw.Create(Blender.drawmap[1])
buttonYStart = Blender.Draw.Create(Blender.drawmap[2])
buttonYMove = Blender.Draw.Create(Blender.drawmap[3])
buttonXStart = Blender.Draw.Create(Blender.drawmap[4])
buttonXMove = Blender.Draw.Create(Blender.drawmap[5])
buttonZoomLevel = Blender.Draw.Create(Blender.drawmap[6])
buttonPath = Blender.Draw.Create(Blender.drawmap[7])
block = []
block.append(("Image Size", buttonthumbsize, 0, 500))
block.append(("Camera Height", buttonCameraHeight, -0, 10))
block.append(("Y Start", buttonYStart, -10, 10))
block.append(("Y Move", buttonYMove, 0, 5))
block.append(("X Start", buttonXStart,-10, 10))
block.append(("X Move", buttonXMove, 0, 5))
block.append(("Zoom Level", buttonZoomLevel, 1, 10))
block.append(("Export Path", buttonPath,0,200,"The Path to save the tiles"))
retval = Blender.Draw.PupBlock("Draw Map: Preferences" , block)
if retval:
Blender.drawmap[0] = buttonthumbsize.val
Blender.drawmap[1] = buttonCameraHeight.val
Blender.drawmap[2] = buttonYStart.val
Blender.drawmap[3] = buttonYMove.val
Blender.drawmap[4] = buttonXStart.val
Blender.drawmap[5] = buttonXMove.val
Blender.drawmap[6] = buttonZoomLevel.val
Blender.drawmap[7] = buttonPath.val
Export()
def Export():
scn = Scene.GetCurrent()
context = scn.getRenderingContext()
def cutStr(str): #cut off path leaving name
c = str.find("\\")
while c != -1:
c = c + 1
str = str[c:]
c = str.find("\\")
str = str[:-6]
return str
#variables from gui:
thumbsize,CameraHeight,YStart,YMove,XStart,XMove,ZoomLevel,Path = Blender.drawmap
XMove = XMove / ZoomLevel
YMove = YMove / ZoomLevel
Camera = Scene.GetCurrent().getCurrentCamera()
Camera.LocZ = CameraHeight / ZoomLevel
YStart = YStart + (YMove / 2)
XStart = XStart + (XMove / 2)
#Point it straight down
Camera.RotX = 0
Camera.RotY = 0
Camera.RotZ = 0
TileCount = 4**ZoomLevel
#Because the first thing we do is move the camera, start it off the map
Camera.LocY = YStart - YMove
for i in range(0,TileCount):
Camera.LocY = Camera.LocY + YMove
Camera.LocX = XStart - XMove
for j in range(0,TileCount):
Camera.LocX = Camera.LocX + XMove
Render.EnableDispWin()
context.extensions = True
context.renderPath = Path
#setting thumbsize
context.imageSizeX(thumbsize)
context.imageSizeY(thumbsize)
#could be put into a gui.
context.imageType = Render.PNG
context.enableOversampling(0)
#render
context.render()
#save image
ZasString = '%s' %(int(ZoomLevel))
XasString = '%s' %(int(j+1))
YasString = '%s' %(int((3-i)+1))
context.saveRenderedImage("Z" + ZasString + "X" + XasString + "Y" + YasString)
#close the windows
Render.CloseRenderWindow()
try:
type(Blender.drawmap)
except:
#print 'initialize extern variables'
init()
show_prefs()
This was relatively simple in the end.
I scaled up the model so that 1 tile on the map was 1 grid in blender.
Set the camera to be orthographic.
Set the scale on the camera to 1 for the highest zoom, 4 for the next one, 16 for the next one and so on.
Updated the start coordinates and move values accordingly.

Categories

Resources