Related
I am following this tutorial (https://towardsdatascience.com/build-your-own-whatsapp-chat-analyzer-9590acca9014) to build a WhatsApp analyzer.
This is the entire code from his tutorial -
def startsWithDateTime(s):
pattern = '^([0-2][0-9]|(3)[0-1])(\/)(((0)[0-9])|((1)[0-2]))(\/)(\d{2}|\d{4}), ([0-9][0-9]):([0-9][0-9]) -'
result = re.match(pattern, s)
if result:
return True
return False
def startsWithAuthor(s):
patterns = [
'([\w]+):', # First Name
'([\w]+[\s]+[\w]+):', # First Name + Last Name
'([\w]+[\s]+[\w]+[\s]+[\w]+):', # First Name + Middle Name + Last Name
'([+]\d{2} \d{5} \d{5}):', # Mobile Number (India)
'([+]\d{2} \d{3} \d{3} \d{4}):', # Mobile Number (US)
'([+]\d{2} \d{4} \d{7})' # Mobile Number (Europe)
]
pattern = '^' + '|'.join(patterns)
result = re.match(pattern, s)
if result:
return True
return False
def getDataPoint(line):
# line = 18/06/17, 22:47 - Loki: Why do you have 2 numbers, Banner?
splitLine = line.split(' - ') # splitLine = ['18/06/17, 22:47', 'Loki: Why do you have 2 numbers, Banner?']
dateTime = splitLine[0] # dateTime = '18/06/17, 22:47'
date, time = dateTime.split(', ') # date = '18/06/17'; time = '22:47'
message = ' '.join(splitLine[1:]) # message = 'Loki: Why do you have 2 numbers, Banner?'
if startsWithAuthor(message): # True
splitMessage = message.split(': ') # splitMessage = ['Loki', 'Why do you have 2 numbers, Banner?']
author = splitMessage[0] # author = 'Loki'
message = ' '.join(splitMessage[1:]) # message = 'Why do you have 2 numbers, Banner?'
else:
author = None
return date, time, author, message
parsedData = [] # List to keep track of data so it can be used by a Pandas dataframe
conversationPath = 'chat.txt'
with open(conversationPath, encoding="utf-8") as fp:
fp.readline() # Skipping first line of the file (usually contains information about end-to-end encryption)
messageBuffer = [] # Buffer to capture intermediate output for multi-line messages
date, time, author = None, None, None # Intermediate variables to keep track of the current message being processed
while True:
line = fp.readline()
if not line: # Stop reading further if end of file has been reached
break
line = line.strip() # Guarding against erroneous leading and trailing whitespaces
if startsWithDateTime(line): # If a line starts with a Date Time pattern, then this indicates the beginning of a new message
print('true')
if len(messageBuffer) > 0: # Check if the message buffer contains characters from previous iterations
parsedData.append([date, time, author, ' '.join(messageBuffer)]) # Save the tokens from the previous message in parsedData
messageBuffer.clear() # Clear the message buffer so that it can be used for the next message
date, time, author, message = getDataPoint(line) # Identify and extract tokens from the line
messageBuffer.append(message) # Append message to buffer
else:
messageBuffer.append(line) # If a line doesn't start with a Date Time pattern, then it is part of a multi-line message. So, just append to buffer
When I plug in my chat file - chat.txt, I noticed that my list parsedData is empty. After going through his code, I noticed what might be responsible for the empty list.
From his tutorial, his chats are in this format (24hrs) -
18/06/17, 22:47 - Loki: Why do you have 2 numbers, Banner? but my chats are this format (12 hrs) - [4/19/20, 8:10:57 PM] Joe: How are you doing.
Reason why the startsWithDateTime function is unable to match any date and time.
Please how do I change the regex format in the startsWithDateTime function to match my chat format?
There are a few problems here.
First, your regex is looking for a date in the format DD/MM/YYYY, but the format you give is in M/DD/YYYY.
Second, the square brackets are not present in the first example you give, which succeeds, but are present in the second example.
Third, in looking at your regex, the problem isn't in the 12-hour v 24-hour time format per se, but in the fact that your regex is searching for a strictly 2-digit hour digit. When using 24-hour format, it is common to include a leading zero for single-digit hours (e.g., 08:10 for 8:10am), but in 12-hour format it is not (so your code would fail to find 8:10.
You can fix your regular expression by changing the relevant section from
([0-9][0-9]):([0-9][0-9])
to
([0-9]{1,2}):([0-9]{2})
The number in curly braces indicates how many examples of that character to look for, so in this case this expression will look for either one or two digits, then a colon, then exactly two digits.
Then the final regex would have to be
^\[(\d{1,2})\/(\d{2})\/(\d{2}|\d{4}), ([0-9]{1,2}):([0-9]{2}):([0-9]{2})\ ([AP]M)\]
Example:
import re
a = '[4/19/20, 8:10:57 PM] Joe: How are you doing'
p = r'^\[(\d{1,2})\/(\d{2})\/(\d{2}|\d{4}), ([0-9]{1,2}):([0-9]{2}):([0-9]{2})\ ([AP]M)\]'
re.findall(p, a)
# [('4', '19', '20', '8', '10', '57', 'PM')]
I am fairly new to Python. I have a text file containing many blocks of data in following format along with other unnecessary blocks.
NOT REQUIRED :: 123
Connected Part-1:: A ~$
Connected Part-3:: B ~$
Connector Location:: 100 200 300 ~$
NOT REQUIRED :: 456
Connected Part-2:: C ~$
i wish to extract the info (A,B,C, 100 200 300) corresponding to each property ( connected part-1, Connector location) and store it as list to use it later. I have prepared following code which reads file, cleans the line and store it as list.
import fileinput
with open('C:/Users/file.txt') as f:
content = f.readlines()
for line in content:
if 'Connected Part-1' in line or 'Connected Part-3' in line:
if 'Connected Part-1' in line:
connected_part_1 = [s.strip(' \n ~ $ Connected Part -1 ::') for s in content]
print ('PART_1:',connected_part_1)
if 'Connected Part-3' in line:
connected_part_3 = [s.strip(' \n ~ $ Connected Part -3 ::') for s in content]
print ('PART_3:',connected_part_3)
if 'Connector Location' in line:
# removing unwanted characters and converting into the list
content_clean_1 = [s.strip('\n ~ $ Connector Location::') for s in content]
#converting a single string item in list to a string
s = " ".join(content_clean_1)
# splitting the string and converting into a list
weld_location= s.split(" ")
print ('POSITION',weld_location)
here is the output
PART_1: ['A', '\t\tConnector Location:: 100.00 200.00 300.00', '\t\tConnected Part-3:: C~\t']
POSITION ['d', 'Part-1::', 'A', '\t\tConnector', 'Location::', '100.00', '200.00', '300.00', '\t\tConnected', 'Part-3::', 'C~\t']
PART_3: ['1:: A', '\t\tConnector Location:: 100.00 200.00 300.00', '\t\tConnected Part-3:: C~\t']
From the output of this program, i may conclude that, since 'content' is the string consisting all the characters in the file, the program is not reading an individual line. Instead it is considering all text as single string. Could anyone please help in this case?
I am expecting following output:
PART_1: ['A']
PART_3: ['C']
POSITION: ['100.00', '200.00','300.00']
(Note) When i am using individual files containing single line of data, it works fine. Sorry for such a long question
I will try to make it clear, and show how I would do it without regex. First of all, the biggest issue with the code presented is that when using the string.strip function the entire content list is being read:
connected_part_1 = [s.strip(' \n ~ $ Connected Part -1 ::') for s in content]
Content is the entire file lines, I think you want simply something like:
connected_part_1 = [line.strip(' \n ~ $ Connected Part -1 ::')]
How to parse the file is a bit subjective, but given the file format posted as input, I would do it like this:
templatestr = "{}: {}"
with open('inputreadlines.txt') as f:
content = f.readlines()
for line in content:
label, value = line.split('::')
ltokens = label.split()
if ltokens[0] == 'Connected':
print(templatestr.format(
ltokens[-1], #The last word on the label
value.split()[:-1])) #the split value without the last word '~$'
elif ltokens[0] == 'Connector':
print(value.split()[:-1]) #the split value without the last word '~$'
else: #NOT REQUIRED
pass
You can use the string.strip function to remove the funny characters '~$' instead of removing the last token as in the example.
I am attempting to create a regular expression pattern for strings similar to the below which are stored in a file. The aim is to get any column for any row, the rows need not be on a single line. So for example, consider the following file:
"column1a","column2a","column
3a,", #entity 1
"column\"this is, a test\"4a"
"column1b","colu
mn2b,","column3b", #entity 2
"column\"this is, a test\"4b"
"column1c,","column2c","column3c", #entity 3
"column\"this is, a test\"4c"
Each entity consists of four columns, column 4 for entity 2 would be "column\"this is, a test\"4b", column 2 for entity 3 would be "column2c". Each column begins with a quote and closes with a quote, however you must be careful because some columns have escaped quotes. Thanks in advance!
You could do like this, ie
Read the whole file.
Split the input according to the newline character which was not preceded by a comma.
Iterate over the spitted elements and again do splitting on the comma (and also the following optional newline character) which was preceded and followed by double quotes.
Code:
import re
with open(file) as f:
fil = f.read()
m = re.split(r'(?<!,)\n', fil.strip())
for i in m:
print(re.split('(?<="),\n?(?=")', i))
Output:
['"column1a"', '"column2a"', '"column3a,"', '"column\\"this is, a test\\"4a"']
['"column1b"', '"column2b,"', '"column3b"', '"column\\"this is, a test\\"4b"']
['"column1c,"', '"column2c"', '"column3c"', '"column\\"this is, a test\\"4c"']
Here is the check..
$ cat f
"column1a","column2a","column3a,",
"column\"this is, a test\"4a"
"column1b","column2b,","column3b",
"column\"this is, a test\"4b"
"column1c,","column2c","column3c",
"column\"this is, a test\"4c"
$ python3 f.py
['"column1a"', '"column2a"', '"column3a,"', '"column\\"this is, a test\\"4a"']
['"column1b"', '"column2b,"', '"column3b"', '"column\\"this is, a test\\"4b"']
['"column1c,"', '"column2c"', '"column3c"', '"column\\"this is, a test\\"4c"']
f is the input file name and f.py is the file-name which contains the python script.
Your problem is terribly familiar to what I have to deal thrice every month :) Except I'm not using python to solve it, but I can 'translate' what I usually do:
text = r'''"column1a","column2a","column
3a,",
"column\"this is, a test\"4a"
"column1a2","column2a2","column3a2","column4a2"
"column1b","colu
mn2b,","column3b",
"column\"this is, a test\"4b"
"column1c,","column2c","column3c",
"column\"this is, a test\"4c"'''
import re
# Number of columns one line is supposed to have
columns = 4
# Temporary variable to hold partial lines
buffer = ""
# Our regex to check for each column
check = re.compile(r'"(?:[^"\\]*|\\.)*"')
# Read the file line by line
for line in text.split("\n"):
# If there's no stored partial line, this is a new line
if buffer == "":
# Check if we get 4 columns and print, if not, put the line
# into buffer so we store a partial line for later
if len(check.findall(line)) == columns:
print matches
else:
# use line.strip() if you need to trim whitespaces
buffer = line
else:
# Update the variable (containing a partial line) with the
# next line and recheck if we get 4 columns
# use line.strip() if you need to trim whitespaces
buffer = buffer + line
# If we indeed get 4, our line is complete and print
# We must not forget to empty buffer now that we got a whole line
if len(check.findall(buffer)) == columns:
print matches
buffer = ""
# Optional; always good to have a safety backdoor though
# If there is a problem with the csv itself like a weird unescaped
# quote, you send it somewhere else
elif len(check.findall(buffer)) > columns:
print "Error: cannot parse line:\n" + buffer
buffer = ""
ideone demo
this is a continuation of Generator not working to split string by particular identifier . Python 2 . however, i modified the code completely and it's not the same format at all. this is about edge cases
Edge Cases:
. when sequence length is different than number of quality values
. when there's an empty sequence or entry
. when the number of lines with quality values is more than one
i cannot figure out how to work with the edge cases above. If its an empty data file, then I still want to output empty strings. i'm trying with these sequences right here for my input file: (Just a little background, IDs are set by # at beginning of line, sequence characters are followed by the lines after until a line with + is reached. the next lines are going to have quality values (value ~= chr(char) ) this format is terrible and poorly thought out.
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs
CTCTCTCATCACACACGAGGAGTGAAGAGAGAACCTCCTCTCCACACGTGGAGTGAGGAGATCCTCTCACACACGTGAGGTGTTGAGAGAGATACTCTCTCATCACCTCACGTGAGGAGTGAGAGAGAT
+
{~~~~~sXNL>>||~~fVM~jtu~&&(uxy~f8YHh=<gA5
''<O1A44N'`oK57(((G&&Q*Q66;"$$Df66E~Z\ZMO>^;%L}~~~~~Q.~~~~x~#-LF9>~MMqbV~ABBV=99mhIwGRR~
#different_number_of_seq_qual
ATCG
+
**!
#this_should_work
GGGG
+
****
The ones with an error, I'm trying to replace the seq and qual strings with empty strings
seq,qual = '',''
Here's my code so far. These edge cases are so difficult for me to figure out please help . . .
def read_fastq(input, offset):
"""
Inputs a fastq file and reads each line at a time. 'offset' parameter can be set to 33 (phred+33 encoding
fastq), and 64. Yields a tuple in the format (ID, comments for a sequence, sequence, [integer quality values])
Capable of reading empty sequences and empty files.
"""
ID, comment, seq, qual = None,'','',''
step = 1 #step is a variable that organizes the order fastq parsing
#step= 1 scans for ID and comment line
#step= 2 adds relevant lines to sequence string
#step= 3 adds quality values to string
for line in input:
line = line.strip()
if step == 1 and line.startswith('#'): #Step system from Nedda Saremi
if ID is not None:
qual = [ord(char)-offset for char in qual] #Converts from phred encoding to integer values
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1) #Separates ID and comment by ' '
yield ID, comment, seq, qual
ID,comment,seq,qual = None,'','','' #Resets variable for next sequence
ID = line[1:]
step = 2
continue
if step==2 and not line.startswith('#') and not line.startswith('+'):
seq = seq + line.strip()
continue
if step == 2 and line.startswith('+'):
step = 3
continue
while step == 3:
#process the quality data
if len(qual) == len(seq):
#once the length of the quality seq and seq are the same, end gathering data
step = 1
continue
if len(qual) < len(seq):
qual = qual + line.strip()
if len(qual) < len(seq):
step = 3
continue
if (len(qual) > len(seq)):
sys.stderr.write('\nError: ' + ID + ' sequence length not equal to quality values\n')
comment,seq,qual= '','',''
ID = line
step = 1
continue
break
if ID is not None:
#Section reserved for last entry in file
if len(qual) > 0:
qual = [ord(char)-offset for char in qual]
sep = None
if ' ' in ID: sep = ' '
if sep is not None:
ID, comment = ID.split(sep,1)
if len(seq) == 0: ID,comment,seq,qual= '','','',''
yield ID, comment, seq, qual
my output is skipping the ID #m120204_092117_richard_c100250832550000001523001204251233_s1_p0/904/ccs and adding #**! when it should not be in the output
#m120204_092117_richard_c100250832550000001523001204251233_s1_p0/422/ccs
CTGTTGCGGATTGTTTGGCTATGGCTAAAACCGATGAAGAAAAAGGAAATGCCAAAACCGTTTATAGCGATTGATCCAAGAAATCCAAAATAAAAGGACACAAAACAAACAAAATCAATTGAGTAAAACAGAAAGGCCATCAAGCAAGCGAGTGCTTGATAACTTAGATGACCCTACTGATCAAGAGGCCATAGAGCAATGTTTAGAGGGCTTGAGCGATAGTGAAAGGGCGCTAATTCTAGGAATTCAAACGACAAGCTGATGAAGTGGATCTGATTTATAGCGATCTAAGAAACCGTAAAACCTTTGATAACATGGCGGCTAAAGGTTATCCGTTGTTACCAATGGATTTCAAAAATGGCGGCGATATTGCCACTATTAACCGCTACTAATGTTGATGCGGACAAATAGCTAGCAGATAATCCTATTTATGCTTCCATAGAGCCTGATATTACCAAGCATACGAAACAGAAAAAACCATTAAGGATAAGAATTTAGAAGCTAAATTGGCTAAGGCTTTAGGTGGCAATAAACAAATGACGATAAAGAAAAAAGTAAAAAACCCACAGCAGAAACTAAAGCAGAAAGCAATAAGATAGACAAAGATGTCGCAGAAACTGCCAAAAATATCAGCGAAATCGCTCTTAAGAACAAAAAAGAAAAGAGTGGGATTTTGTAGATGAAAATGGTAATCCCATTGATGATAAAAAGAAAGAAGAAAAACAAGATGAAACAAGCCCTGTCAAACAGGCCTTTATAGGCAAGAGTGATCCCACATTTGTTTTTAGCGCAATACACCCCCATTGAAATCACTCTGACTTCTAAAGTAGATGCCACTCTCACAGGTATAGTGAGTGGGGTTGTAGCCAAAGATGTATGGAACATGAACGGCACTATGATCTTATTAAGACAAACGGCCACTAAGGTGTATGGGAATTATCAAAGCGTGAAAGGTGGCCACGCCTATTATGACTCGTTTAATGATAGTCTTTACTAAAGCCATTACGCCTGATGGGGTGGTGATACCTCTAGCAAACGCTCAAGCAGCAGGCATGCTGGGTGAAGCAGGCGGTAGATGGCTATGTGAATAATCACTTCATGAAGCGTATAGGCTTTGCTGTGATAGCAAGCGTGGTTAATAGCTTCTTGCAAACTGCACCTATCATAGCTCTAGATAAACTCATAGGCCTTGGCAAAGGCAGAAGTGAAAGGACACCTGAATTTAATTACGCTTTGGGTCAAGCTATCAATGGTAGTATGCAAAGTTCAGCTCAGATGTCTAATCAAATTCTAGGGCAACTGATGAATATCCCCCAAGTTTTTACAAAAATGAGGGCGATAGTATTAAGATTCTCACCATGGACGATATTGATTTTAGTGGTGTGTATGATGTTAAAATTGACCAACAAATCTGTGGTAGATGAAATTATCAAACAAAGCACCAAAAACTTTGTCTAGAGAACATGAAGAAATCACCACAGCCCCAAAGGTGGCAATTGATTCAAGAGAAAGGATAAAATATATTCATGTTATTAAACTCGGTTCTTTACAAAATAAAAAGACAAACCAACCTAGGCTCTTCTAGAGGA
+
J(78=AEEC65HR+++*3327H00GD++++FF440.+-64444426ABAB<:=7888((/788P>>LAA8*+')3&++=<////==<4&<>EFHGGIJ66P;;;9;;FE34KHKHP<<11;HK:57678NJ990((&26>PDDJE,,JL>=##88,8,+>::J88ELF9.-5.45G+###NP==??<>455F((<BB===;;EE;3><<;M=>89PLLPP?>KP8+7699>A;ANO===J#'''B;.(...HP?E##AHGE77MNOO9=OO?>98?DLIMPOG>;=PRKB5H---3;MN&&&&&F?B>;99;8AA53)A<=;>777:<>;;8:LM==))6:#K..M?6?::7,/4444=JK>>HNN=//16#--F#K;9<:6449#BADD;>CD11JE55K;;;=&&%%,3644DL&=:<877..3>344:>>?44*+MN66PG==:;;?0./AGLKF99&&5?>+++JOP333333AC#EBBFBCJ>>HINPMNNCC>>++6:??3344>B=<89:/000::K>A=00#,+-/.,#(LL#>#I555K22221115666666477KML559-,333?GGGKCCP:::PPNPPNP??PPPLLMNOKKFOP2Q&&P7777PM<<<=<6<HPOPPP44?=#=:?BB=89:<<DHI777777645545PPO((((((((C3P??PM0000#NOPJPPFGGL<<<NNGNKGGGGGEELKB'''(((((L===L<<..*--MJ111?PO=788<8GG>>?JJL88,,1CF))??=?M6667PPKAKM&&&&&<?P43?OENPP''''&5579ICIFRPPPPOP>:>>>P888PLPAJDPCCDMMD;9=FBADDJFD7;ALL?,,,,06ID13..000DA4CFJC44,,->ED99;44CJK?42FAB?=CLNO''PJI999&77&&ERP><)))O==D677FP768PA=##HEE.::NM&&&>O''PO88H#A999P<:?IHL;;;GIIPPMMPPB7777PP>>>>KOPIIEEE<<CL%%5656AAAG<<DDFFGG%%N21778;M&&>>CCL::LKK6.711DGHHMIA#BAJ7>%6700;;=##?=;J55>>QP<<:>MF;;RPL==JMMPPPQR##P===;=BM99M>>PPOQGD44777PKKFP=<'''2215566>CG>>HH<<PLJI800CE<<PPPMGNOPMJ>>GG***LCCC777,,#AP>>AOPMFN99ENNMEPP>>>>>>CLPP??66OOKLLP=:>>KMBCPOPP#FKEI<<ML?>EAF>>>LDCD77JK=H>BN==:=<<<:==JN,,,659???8K<:==<4))))))P98>>>>;967777N66###AMKKKIKPMG;;AD88HN&&LMIGJOJMGHPC>#5D((((C?9--?8HGCDPNH7?9974;;AC&ABH''#%:=NP:,,9999=GJG>>=>JG21''':9>>>;;MP*****OKKKIE??55PPKJ21:K---///Q11//EN&';;;;:=;00011;IP##PP11?778JDDMM>>::KKLLKLNONOHDMPKLMIB>>?JP>9;KJL====;8;;;L)))))E#=$$$#.::,,BPJK76B;;F5<<J::K
Error: different_number_of_seq_qual sequence length not equal to quality values
#**!
+
#this_should_work
GGGG
+
****
You probably should use BioPython.
Your bug appears to be the read that is skipped has 129 bases in its sequence but only 128 qv. So your parser reads the next defline as a quality line which then makes it too long so it prints the error.
Then your states don't account for the situation of where you are in step 1 but dont see a defline. So you keep reading extra lines overwritting the ID variable.
but if you really want to write your own parser:
I'll address your questions one at a time.
when sequence length is different than number of quality values
This is invalid. Each record in the fastq file must have the an equal number of bases and qualities. Different records in the file can be different lengths from each other, but each record must have equal bases and qualities.
when there's an empty sequence or entry
An empty read will have blank lines for the sequence and quality lines like this:
#SOLEXA1_0007:1:9:610:1983#GATCAG/2
+SOLEXA1_0007:1:9:610:1983#GATCAG/2
#SOLEXA1_0007:2:13:163:254#GATCAG/2
CGTAGTACGATATACGCGCGTGTACTGCTACGTCTCACTTTCGCAAGATTGCTCAGCTCATTGATGCTCAATGCTGGGCCATATCTCTTTTCTTTTTTTC
+SOLEXA1_0007:2:13:163:254#GATCAG/2
HHHHGHHEHHHHHE=HAHCEGEGHAG>CHH>EG5#>5*ECE+>AEEECGG72B&A*)569B+03B72>5.A>+*A>E+7A#G<CAD?#############
when the number of lines with quality values is more than one
Due to the requirements from the first answer above. We know that the number of bases and qualities must match. Also there will never be an + character in the sequence block. So we can keep parsing the sequence block until we see a line that starts with +. Then we know we are done parsing sequence. Then we can keep parsing quality lines until we get the same number of qualities as is in the sequence. We can't rely on looking for any special characters because depending on the quality encoding, # could be a valid quality call.
Also as an aside, you appear to be splitting the sequence defline to parse out the optional comment. You have to be careful for CASAVA 1.8 format which stupidly has spaces. So you might need a regex to see if it's a CASAVA 1.8 format then don't split on whitespace etc.
Have you considered using one of the robust python packages that are available for dealing with this kind of data rather than writing a parser from scratch? In partincular I'd recommend checking out HTSeq
I have a large list of images that have been misnamed by my artist. I was hoping to avoid giving him more work by using Automator but I'm new to it. Right now they're named in order what001a and what002a but that should be what001a and what001b. So basically odd numbered are A and even numbered at B. So i need a script that changes the even numbered to B images and renumbers them all to the proper sequential numbering. How would I go about writing that script?
A small Ruby script embedded in an AppleScript provides a very comfortable solution, allowing you to select the files to rename right in Finder and displaying an informative success or error message.
The algorithm renames files as follows:
number = first 3 digits in filename # e.g. "006"
letter = the letter following those digits # e.g. "a"
if number is even, change letter to its successor # e.g. "b"
number = (number + 1)/2 # 5 or 6 => 3
replace number and letter in filename
And here it is:
-- ask for files
set filesToRename to choose file with prompt "Select the files to rename" with multiple selections allowed
-- prepare ruby command
set ruby_script to "ruby -e \"s=ARGV[0]; m=s.match(/(\\d{3})(\\w)/); n=m[1].to_i; a=m[2]; a.succ! if n.even?; r=sprintf('%03d',(n+1)/2)+a; puts s.sub(/\\d{3}\\w/,r);\" "
tell application "Finder"
-- process files, record errors
set counter to 0
set errors to {}
repeat with f in filesToRename
try
do shell script ruby_script & (f's name as text)
set f's name to result
set counter to counter + 1
on error
copy (f's name as text) to the end of errors
end try
end repeat
-- display report
set msg to (counter as text) & " files renamed successfully!\n"
if errors is not {} then
set AppleScript's text item delimiters to "\n"
set msg to msg & "The following files could NOT be renamed:\n" & (errors as text)
set AppleScript's text item delimiters to ""
end if
display dialog msg
end tell
Note that it will fail when the filename contains spaces.
A friend of mine wrote a Python script to do what I needed. Figured I'd post it here as an answer for anyone stumbling upon a similar problem looking for help. It is in Python though so if anyone wants to convert it to AppleScript for those that may need it go for it.
import os
import re
import shutil
def toInt(str):
try:
return int(str)
except:
return 0
filePath = "./"
extension = "png"
dirList = os.listdir(filePath)
regx = re.compile("[0-9]+a")
for filename in dirList:
ext = filename[-len(extension):]
if(ext != extension): continue
rslts = regx.search(filename)
if(rslts == None): continue
pieces = regx.split(filename)
if(len(pieces) < 2): pieces.append("")
filenumber = toInt(rslts.group(0).rstrip("a"))
newFileNum = (filenumber + 1) / 2
fileChar = "b"
if(filenumber % 2): fileChar = "a"
newFileName = "%s%03d%s%s" % (pieces[0], newFileNum, fileChar, pieces[1])
shutil.move("%s%s" % (filePath, filename), "%s%s" % (filePath, newFileName))