Develop Reference

how to replace (or delete) a part of string from txt file in python

i am very new in python (and programming in general) and here is my issue. i would like to replace (or delete) a part of a string from a txt file which contains hundreds or thousands of lines. each line starts with the very same string which i want to delete.
i have not found a method to delete it so i tried a replace it with empty string but for some reason it doesn't work.
here is what i have written:
file = "C:/Users/experimental/Desktop/testfile siera.txt"
siera_log = open(file)
text_to_replace = "Chart: Bar Backtest: NQU8-CME [CB] 1 Min #1 | Study: free dll = 0 |"
for each_line in siera_log:
new_line = each_line.replace("text_to_replace", " ")
print(new_line)
when i print it to check if it was done, i can see that the lines are as they were before. no change was made.
can anyone help me to find out why?

each line starts with the very same string which i want to delete.
The problem is you're passing a string "text_to_replace" rather than the variable text_to_replace.
But, for this specific problem, you could just remove the first n characters from each line:
text_to_replace = "Chart: Bar Backtest: NQU8-CME [CB] 1 Min #1 | Study: free dll = 0 |"
n = len(text_to_replace)
for each_line in siera_log:
new_line = each_line[n:]
print(new_line)

If you quote a variable it becomes a string literal and won't be evaluated as a variable.
Change your line for replacement to:
new_line = each_line.replace(text_to_replace, " ")

Regex remove certain characters from a file

I'd like to write a python script that reads a text file containing this:
FRAME
1 J=1,8 SEC=CL1 NSEG=2 ANG=0
2 J=8,15 SEC=CL2 NSEG=2 ANG=0
3 J=15,22 SEC=CL3 NSEG=2 ANG=0
And output a text file that looks like this:
1 1 8
2 8 15
3 15 22
I essentially don't need the commas or the SEC, NSEG and ANG data. Could someone help me use regex to do this?
So far I have this:
import re
r = re.compile(r"\s*(\d+)\s+J=(\S+)\s+SEC=(\S+)\s+NSEG=(\S+)+ANG=(\S+)\s")
with open('RawDataFile_445.txt') as a:
# open all 4 files with a meaningful name
file=[open(outputfile.txt","w")
for line in a:

Without regex:
for line in file:
keep = []
line = line.strip()
if line.startswith('FRAME'):
continue
first, second, *_ = line.split()
keep.append(first)
first, second = second.split('=')
keep.extend(second.split(','))
print(' '.join(keep))

My advice? Since I don't write many regex's I avoid writing big ones all at once. Since you've already done that I would try to verify it a small chunk at a time, as illustrated in this code.
import re
r = re.compile(r"\s*(\d+)\s+J=(\S+)\s+SEC=(\S+)\s+NSEG=(\S+)+ANG=(\S+)\s")
r = re.compile(r"\s*(\d+)")
r = re.compile(r"\s*(\d+)\s+J=(\d+)")
with open('RawDataFile_445.txt') as a:
a.readline()
for line in a.readlines():
result = r.match(line)
if result:
print (result.groups())
The first regex is your entire brute of an expression. The next line is the first chunk I verified. The next line is the second, bigger chunk that worked. Notice the slight change.
At this point I would go back, make the correction to the original, whole regex and then copy a bigger chunk to try. And re-run.

Let's focus on an example string we want to parse:
1 J=1,8
We have space(s), digit(s), more space(s), some characters, then digit(s), a comma, and more digit(s). If we replace them with regex characters, we get (\d+)\s+J=(\d+),(\d+), where + means we want 1 or more of that type. Note that we surround the digits with parentheses so we can capture them later with .groups() or .group(#), where # is the nth group.

Python - Files - Changing line numbers based on search results

I need to search a debug file for a specific string or error and then, once it's found, look up the file by 6 lines and then print whatever that line 6 above has in it.
import linecache
file = "/file.txt"
fh = open("/file.txt", "r")
lookup = 'No Output'
with fh as myFile:
for num, line in enumerate(myFile, 1):
if lookup in line:
numUp = num + 6
new = linecache.getline(file, numUp)
print new
I tried adding doing something along the lines of "num += 6" whenever I find "The term I need to search" but my output is either blank or I receive this error:
File "testRead.py", line 12
print new
^
IndentationError: unexpected indent
If there's also another way to do "search, then scan up n-lines, then print/return" in a way that's line by line, that'd be great to know as well because the files I'll be working with vary greatly in size.
I upped an example file of some of the things I typically see: http://pastebin.com/mzvCfZid
Any time I hit the string "(Err: No Output)", I need to find its associated ID, which is the number 6 lines above the error. So "No Output is what I'd need to search for.
::Edit::

You want the functionality of a deque:
>>> from collections import deque
>>>
>>> lines = deque(maxlen = 7)
>>> for i in range(35):
... lines.append(i)
...
>>> print lines
# Note your 6 lines earlier would be lines[0] here.
deque([28, 29, 30, 31, 32, 33, 34], maxlen=7)

How do you make tables with previously stored strings?

So the question basically gives me 19 DNA sequences and wants me to makea basic text table. The first column has to be the sequence ID, the second column the length of the sequence, the third is the number of "A"'s, 4th is "G"'s, 5th is "C", 6th is "T", 7th is %GC, 8th is whether or not it has "TGA" in the sequence. Then I get all these values and write a table to "dna_stats.txt"
Here is my code:
fh = open("dna.fasta","r")
Acount = 0
Ccount = 0
Gcount = 0
Tcount = 0
seq=0
alllines = fh.readlines()
for line in alllines:
if line.startswith(">"):
seq+=1
continue
Acount+=line.count("A")
Ccount+=line.count("C")
Gcount+=line.count("G")
Tcount+=line.count("T")
genomeSize=Acount+Gcount+Ccount+Tcount
percentGC=(Gcount+Ccount)*100.00/genomeSize
print "sequence", seq
print "Length of Sequence",len(line)
print Acount,Ccount,Gcount,Tcount
print "Percent of GC","%.2f"%(percentGC)
if "TGA" in line:
print "Yes"
else:
print "No"
fh2 = open("dna_stats.txt","w")
for line in alllines:
splitlines = line.split()
lenstr=str(len(line))
seqstr = str(seq)
fh2.write(seqstr+"\t"+lenstr+"\n")
I found that you have to convert the variables into strings. I have all of the values calculated correctly when I print them out in the terminal. However, I keep getting only 19 for the first column, when it should go 1,2,3,4,5,etc. to represent all of the sequences. I tried it with the other variables and it just got the total amounts of the whole file. I started trying to make the table but have not finished it.
So my biggest issue is that I don't know how to get the values for the variables for each specific line.
I am new to python and programming in general so any tips or tricks or anything at all will really help.
I am using python version 2.7

Well, your biggest issue:
for line in alllines: #1
...
fh2 = open("dna_stats.txt","w")
for line in alllines: #2
....
Indentation matters. This says "for every line (#1), open a file and then loop over every line again(#2)..."
De-indent those things.

This puts the info in a dictionary as you go and allows for DNA sequences to go over multiple lines
from __future__ import division # ensure things like 1/2 is 0.5 rather than 0
from collections import defaultdict
fh = open("dna.fasta","r")
alllines = fh.readlines()
fh2 = open("dna_stats.txt","w")
seq=0
data = dict()
for line in alllines:
if line.startswith(">"):
seq+=1
data[seq]=defaultdict(int) #default value will be zero if key is not present hence we can do +=1 without originally initializing to zero
data[seq]['seq']=seq
previous_line_end = "" #TGA might be split accross line
continue
data[seq]['Acount']+=line.count("A")
data[seq]['Ccount']+=line.count("C")
data[seq]['Gcount']+=line.count("G")
data[seq]['Tcount']+=line.count("T")
data[seq]['genomeSize']+=data[seq]['Acount']+data[seq]['Gcount']+data[seq]['Ccount']+data[seq]['Tcount']
line_over = previous_line_end + line[:3]
data[seq]['hasTGA']= data[seq]['hasTGA'] or ("TGA" in line) or (TGA in line_over)
previous_line_end = str.strip(line[-4:]) #save previous_line_end for next line removing new line character.
for seq in data.keys():
data[seq]['percentGC']=(data[seq]['Gcount']+data[seq]['Ccount'])*100.00/data[seq]['genomeSize']
s = '%(seq)d, %(genomeSize)d, %(Acount)d, %(Ccount)d, %(Tcount)d, %(Tcount)d, %(percentGC).2f, %(hasTGA)s'
fh2.write(s % data[seq])
fh.close()
fh2.close()

patterns searching in text

I have text file as follows seq.txt
>S1
AACAAGAAGAAAGCCCGCCCGGAAGCAGCTCAATCAGGAGGCTGGGCTGGAATGACAGCG
CAGCGGGGCCTGAAACTATTTATATCCCAAAGCTCCTCTCAGATAAACACAAATGACTGC
GTTCTGCCTGCACTCGGGCTATTGCGAGGACAGAGAGCTGGTGCTCCATTGGCGTGAAGT
CTCCAGGGCCAGAAGGGGCCTTTGTCGCTTCCTCACAAGGCACAAGTTCCCCTTCTGCTT
CCCCGAGAAAGGTTTGGTAGGGGTGGTGGTTTAGTGCCTATAGAACAAGGCATTTCGCTT
CCTAGACGGTGAAATGAAAGGGAAAAAAAGGACACCTAATCTCCTACAAATGGTCTTTAG
TAAAGGAACCGTGTCTAAGCGCTAAGAACTGCGCAAAGTATAAATTATCAGCCGGAACGA
GCAAACAGACGGAGTTTTAAAAGATAAATACGCATTTTTTTCCGCCGTAGCTCCCAGGCC
AGCATTCCTGTGGGAAGCAAGTGGAAACCCTATAGCGCTCTCGCAGTTAGGAAGGAGGGG
TGGGGCTGTCCCTGGATTTCTTCTCGGTCTCTGCAGAGACAATCCAGAGGGAGACAGTGG
ATTCACTGCCCCCAATGCTTCTAAAACGGGGAGACAAAACAAAAAAAAACAAACTTCGGG
TTACCATCGGGGAACAGGACCGACGCCCAGGGCCACCAGCCCAGATCAAACAGCCCGCGT
CTCGGCGCTGCGGCTCAGCCCGACACACTCCCGCGCAAGCGCAGCCGCCCCCCCGCCCCG
GGGGCCCGCTGACTACCCCACACAGCCTCCGCCGCGCCCTCGGCGGGCTCAGGTGGCTGC
GACGCGCTCCGGCCCAGGTGGCGGCCGGCCGCCCAGCCTCCCCGCCTGCTGGCGGGAGAA
ACCATCTCCTCTGGCGGGGGTAGGGGCGGAGCTGGCGTCCGCCCACACCGGAAGAGGAAG
TCTAAGCGCCGGAAGTGGTGGGCATTCTGGGTAACGAGCTATTTACTTCCTGCGGGTGCA
CAGGCTGTGGTCGTCTATCTCCCTGTTGTTC
>S2
ACACGCATTCACTAAACATATTTACTATGTGCCAGGCACTGTTCTCAGTGCTGGGGATAT
AGCAGTGAAGAAACAGAAACCCTTGCACTCACTGAGCTCATATCTTAGGGTGAGAAACAG
TTATTAAGCAAGATCAGGATGGAAAACAGATGGTACGGTAGTGTGAAATGCTAAAGAGAA
AAATAACTACGGAAAAGGGATAGGAAGTGTGTGTATCGCAGTTGACTTATTTGTTCGCGT
TGTTTACCTGCGTTCTGTCTGCATCTCCCACTAAACTGTAAGCTCTACATCTCCCATCTG
TCTTATTTACCAATGCCAACCGGGGCTCAGCGCAGCGCCTGACACACAGCAGGCAGCTGA
CAGACAGGTGTTGAGCAAGGAGCAAAGGCGCATCTTCATTGCTCTGTCCTTGCTTCTAGG
AGGCGAATTGGGAAATCCAGAGGGAAAGGAAAAGCGAGGAAAGTGGCTCGCTTTTGGCGC
TGGGGAAGAGGTGTACAGTGAGCAGTCACGCTCAGAGCTGGCTTGGGGGACACTCTCACG
CTCAGGAGAGGGACAGAGCGACAGAGGCGCTCGCAGCAGCGCGCTGTACAGGTGCAACAG
CTTAGGCATTTCTATCCCTATTTTTACAGCGAGGGACACTGGGCCTCAGAAAGGGAAGTG
CCTTCCCAAGCTCCAACTGCTCATAAGCAGTCAACCTTGTCTAAGTCCAGGTCTGAAGTC
CTGGAGCGATTCTCCACCCACCACGACCACTCACCTACTCGCCTGCGCTTCACCTCACGT
GAGGATTTTCCAGGTTCCTCCCAGTCTCTGGGTAGGCGGGGAGCGCTTAGCAGGTATCAC
CTATAAGAAAATGAGAATGGGTTGGGGGCCGGTGCAAGACAAGAATATCCTGACTGTGAT
TGGTTGAATTGGCTGCCATTCCCAAAACGAGCTTTGGCGCCCGGTCTCATTCGTTCCCAG
CAGGCCCTGCGCGCGGCAACATGGCGGGGTCCAGGTGGAGGTCTTGAGGCTATCAGATCG
GTATGGCATTGGCGTCCGGGCCCGCAAGGCG
.
.
.
.
I have to count patterns in these sequences to achieve python script
import re
infile = open("seq.txt", 'r')
out = open("pat.txt", 'w')
pattern = re.compile("GAAAT", flags=re.IGNORECASE)
for line in infile:
line = line.strip("\n")
if line.startswith('>'):
name = line
else:
s = re.findall(pattern,line)
print '%s:%s' %(name,s)
out.write('%s:\t%s\n' %(name,len(s)))
But it is giving the wrong result. The script is reading line by line.
S1 : 0
S1 : 0
S1 : 0
S1 : 0
S2 : 0
S2 : 1
S2 : 0
S2 : 1
But I want output as follows:
S1 : 0
S2 : 2
Can anybody help?

Use a hit counter, zero it if line.startswith('>'). Increment by len(s) otherwise.

This code might be helpful for you:
import re
pattern = re.compile("GAAAT", flags=re.IGNORECASE)
with open('seq.txt') as f:
sections = f.read().split('\n\n')
for section in sections:
lines = section.split()
name = lines[0].lstrip('>')
data = ''.join(lines[1:])
print '{0}: {1}'.format(name, len(pattern.findall(data)))
Example output:
S1: 1
S2: 2
Notes:
It's assumed that two newline characters are used to separate every section as in the example.
It's assumed that every section name is preceded by a greater than (>) character as in the example.
If you already have a pattern, use pattern.findall(data) instead of re.findall(pattern, data)

You should gather input until you enter the next pattern. This would also solve the corner case of where your pattern crosses a line boundary (not sure if that "can" happen with your data, but it looks like it).

Use a counter. Also, have your print function inside the for loop, so it's going to iterate as many times as the else condition. Note that it's also not a good idea to use the variable line as both the iterator variable in the for loop and as another variable. It makes the code more confusing.
counter_dict = {}
for line in infile:
if line[0] == '>':
name = line[1:len(line) - 2]
counter_dict[name] = 0
else:
counter_dict[name] += len(re.findall(pattern,line))
for (key, val) in counter_dict.items():
print '%s:%s' %(key, val)
out.write('%s:\t%s\n' %(key, val)