Ways to read/edit multiple lines in python - python

What i'm trying to do is to take 4 lines from a file that look like this:
#blablabla
blablabla #this string needs to match the amount of characters in line 4
!blablabla
blablabla #there is a string here
This goes on for a few hundred times.
I read the entire thing line by line, make a change to the fourth line, then want to match the second line's character count to the amount in the fourth line.
I can't figure out how to "backtrack" and change the second line after making changes to the fourth.
with fileC as inputA:
for line1 in inputA:
line2 = next(inputA)
line3 = next(inputA)
line4 = next(inputA)
is what i'm currently using, because it lets me handle 4 lines at the same time, but there has to be a better way as causes all sorts of problems when writing away the file. What could I use as an alternative?

you could do:
with open(filec , 'r') as f:
lines = f.readlines() # readlines creates a list of the lines
to access line 4 and do something with it you would access:
lines[3] # as lines is a list
and for line 2
lines[1] # etc.
You could then write your lines back into a file if you wish
EDIT:
Regarding your comment, perhaps something like this:
def change_lines(fileC):
with open(fileC , 'r') as f:
while True:
lines = []
for i in range(4):
try:
lines.append(f.next()) # f.next() returns next line in file
except StopIteration: # this will happen if you reach end of file before finding 4 more lines.
#decide what you want to do here
return
# otherwise this will happen
lines[2] = lines[4] # or whatever you want to do here
# maybe write them to a new file
# remember you're still within the for loop here
EDIT:
Since your file divides into fours evenly, this works:
def change_lines(fileC):
with open(fileC , 'r') as f:
while True:
lines = []
for i in range(4):
try:
lines.append(f.next())
except StopIteration:
return
code code # do something with lines here
# and write to new file etc.

Another way to do it:
import sys
from itertools import islice
def read_in_chunks(file_path, n):
with open(file_path) as fh:
while True:
lines = list(islice(fh, n))
if lines: yield lines
else: break
for lines in read_in_chunks(sys.argv[1], 4):
print lines
Also relevant is the grouper() recipe in the itertools module. In that case, you would need to filter out the None values before yielding them to the caller.

You could read the file with .readlines and then index which ever line you want to change and write that back to the file:
rf = open('/path/to/file')
file_lines = rf.readlines()
rf.close()
line[1] = line[3] # trim/edit however you'd like
wf = open('/path/to/write', 'w')
wf.writelines(file_lines)
wf.close()

Related

How can I handle multiple lines at once while reading from a file?

The standard Python approach to working with files using the open() function to create a 'file object' f allows you to either load the entire file into memory at once using f.read() or to read lines one-by-one using a for loop:
with open('filename') as f:
# 1) Read all lines at once into memory:
all_data = f.read()
# 2) Read lines one-by-one:
for line in f:
# Work with each line
I'm searching through several large files looking for a pattern that might span multiple lines. The most intuitive way to do this is to read line-by-line looking for the beginning of the pattern, and then to load in the next few lines to see where it ends:
with open('large_file') as f:
# Read lines one-by-one:
for line in f:
if line.startswith("beginning"):
# Load in the next line, i.e.
nextline = f.getline(line+1) # ??? #
# or something
The line I've marked with # ??? # is my own pseudocode for what I imagine this should look like.
My question is, does this exist in Python? Is there any method for me to access other lines as needed while keeping the cursor at line and without loading the entire file into memory?
Edit Inferring from the responses here and other reading, the answer is "No."
Like this:
gather = []
for line in f:
if gather:
gather.append(line)
if "ending" in line:
process( ''.join(gather) )
gather = []
elif line.startswith("beginning"):
gather = [line]
Although in many cases it's easier just to load the whole file into a string and search it.
You may want to rstrip the newline before appending the line.
Just store the interesting lines into a list while going line-wise through the file:
with open("file.txt","w") as f:
f.write("""
a
b
------
c
d
e
####
g
f""")
interesting_data = []
inside = False
with open ("file.txt") as f:
for line in f:
line = line.strip()
# start of interesting stuff
if line.startswith("---"):
inside = True
# end of interesting stuff
elif line.startswith("###"):
inside = False
# adding interesting bits
elif inside:
interesting_data.append(line)
print(interesting_data)
to get
['c', 'd', 'e']
I think you're looking for .readline(), which does exactly that. Here is a sketch to proceed to the line where a pattern starts.
with open('large_file') as f:
line = f.readline()
while not line.startswith("beginning"):
line = f.readline()
# end of file
if not line:
print("EOF")
break
# do_something with line, get additional lines by
# calling .readline() again, etc.

Changing the contents of a text file and making a new file with same format

I have a big text file with a lot of parts. Every part has 4 lines and next part starts immediately after the last part.
The first line of each part starts with #, the 2nd line is a sequence of characters, the 3rd line is a + and the 4th line is again a sequence of characters.
Small example:
#M00872:462:000000000-D47VR:1:1101:15294:1338 1:N:0:ACATCG
TGCTCGGTGTATGTAAACTTCCGACTTCAACTGTATAGGGATCCAATTTTGACAAAATATTAACGCTTATCGATAAAATTTTGAATTTTGTAACTTGTTTTTGTAATTCTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCCCCTGCACTGTACCCCCCAATCCCCCCTTTTCTTTTAAAAGTTAACCGATACCGTCGAGATCCGTTCACTAATCGAACGGATCTGTCTCTGTCTCTCTC
+
BAABBADBBBFFGGGGGGGGGGGGGGGHHGHHGH55FB3A3GGH3ADG5FAAFEGHHFFEFHD5AEG1EF511F1?GFH3#BFADGD55F?#GFHFGGFCGG/GHGHHHHHHHDBG4E?FB?BGHHHHHHHHHHHHHHHHHFHHHHHHHHHGHGHGHHHHHFHHHHHGGGGHHHHGGGGHHHHHHHGHGHHHHHHFGHCFGGGHGGGGGGGGFGGEGBFGGGGGGGGGFGGGGFFB9/BFFFFFFFFFF/
I want to change the 2nd and the 4th line of each part and make a new file with similar structure (4 lines for each part). In fact I want to keep the 1st 65 characters (in lines 2 and 4) and remove the rest of characters. The expected output for the small example would look like this:
#M00872:462:000000000-D47VR:1:1101:15294:1338 1:N:0:ACATCG
TGCTCGGTGTATGTAAACTTCCGACTTCAACTGTATAGGGATCCAATTTTGACAAAATATTAACG
+
BAABBADBBBFFGGGGGGGGGGGGGGGHHGHHGH55FB3A3GGH3ADG5FAAFEGHHFFEFHD5A
I wrote the following code:
infile = open("file.fastq", "r")
new_line=[]
for line_number in len(infile.readlines()):
if line_number ==2 or line_number ==4:
new_line.append(infile[line_number])
with open('out_file.fastq', 'w') as f:
for item in new_line:
f.write("%s\n" % item)
but it does not return what I want. How to fix it to get the expected output?
This code will achieve what you want -
from itertools import islice
with open('bio.txt', 'r') as infile:
while True:
lines_gen = list(islice(infile, 4))
if not lines_gen:
break
a,b,c,d = lines_gen
b = b[0:65]+'\n'
d = d[0:65]+'\n'
with open('mod_bio.txt', 'a+') as f:
f.write(a+b+c+d)
How it works?
We first make a generator that gives 4 lines at a time as you mention.
Then we open the lines into individual lines a,b,c,d and perform string slicing. Eventually we join that string and write it to a new file.
I think some itertools.cycle could be nice here:
import itertools
with open("transformed.file.fastq", "w+") as output_file:
with open("file.fastq", "r") as input_file:
for i in itertools.cycle((1,2,3,4)):
line = input_file.readline().strip()
if not line:
break
if i in (2,4):
line = line[:65]
output_file.write("{}\n".format(line))
readlines() will return list of each line in your file. You don't need to prepare a list new_line. Directly iterate over index-value pair of list, then you can modify all the values in your desired position.
By modifying your code, try this
infile = open("file.fastq", "r")
new_lines = infile.readlines()
for i, t in enumerate(new_lines):
if i == 1 or i == 3:
new_lines[i] = new_lines[i][:65]
with open('out_file.fastq', 'w') as f:
for item in new_lines:
f.write("%s" % item)

to read from a text file 4 lines or several lines at a time

I'm trying to write a code for a cellphone register on python. I'm suppose to read diffrent contacts from a text file. Every contact person on the list takes about 4 lines, I tried to read one line at a time(it works), But I wonder if there is easier way, for example to read 4 lines directly och creat an object list or a list, is it possible? if it is how?
I'm not sure what you mean by 'about 4 lines', but here's a start:
with open('thefile.txt') as infile:
while True:
parts = [infile.readline() for _ in range(4)]
if not any(parts):
break
part1, part2, part3, part4 = parts
Assume the file you try to read is contacts.txt and it's at current path
with open('contacts.txt','r') as f:
lines = f.readlines()
for i in xrange(0,len(lines),4):
contact_source = lines[0:i]
BuildObject(contact_source)
You can possibly use a generator function like this (You don't need to read the entire file initially here),
def multilinefile(fn, no_lns):
f, lines = open(fn), []
while '' not in lines:
lines = map(lambda s: f.readline(), range(no_lns))
if lines[0] == '':
break
yield ''.join(lines)
for line in multilinefile(your_file, 4):
print line

How to only read lines in a text file after a certain string?

I'd like to read to a dictionary all of the lines in a text file that come after a particular string. I'd like to do this over thousands of text files.
I'm able to identify and print out the particular string ('Abstract') using the following code (gotten from this answer):
for files in filepath:
with open(files, 'r') as f:
for line in f:
if 'Abstract' in line:
print line;
But how do I tell Python to start reading the lines that only come after the string?
Just start another loop when you reach the line you want to start from:
for files in filepath:
with open(files, 'r') as f:
for line in f:
if 'Abstract' in line:
for line in f: # now you are at the lines you want
# do work
A file object is its own iterator, so when we reach the line with 'Abstract' in it we continue our iteration from that line until we have consumed the iterator.
A simple example:
gen = (n for n in xrange(8))
for x in gen:
if x == 3:
print('Starting second loop')
for x in gen:
print('In second loop', x)
else:
print('In first loop', x)
Produces:
In first loop 0
In first loop 1
In first loop 2
Starting second loop
In second loop 4
In second loop 5
In second loop 6
In second loop 7
You can also use itertools.dropwhile to consume the lines up to the point you want:
from itertools import dropwhile
for files in filepath:
with open(files, 'r') as f:
dropped = dropwhile(lambda _line: 'Abstract' not in _line, f)
next(dropped, '')
for line in dropped:
print(line)
Use a boolean to ignore lines up to that point:
found_abstract = False
for files in filepath:
with open(files, 'r') as f:
for line in f:
if 'Abstract' in line:
found_abstract = True
if found_abstract:
#do whatever you want
You can use itertools.dropwhile and itertools.islice here, a pseudo-example:
from itertools import dropwhile, islice
for fname in filepaths:
with open(fname) as fin:
start_at = dropwhile(lambda L: 'Abstract' not in L.split(), fin)
for line in islice(start_at, 1, None): # ignore the line still with Abstract in
print line
To me, the following code is easier to understand.
with open(file_name, 'r') as f:
while not 'Abstract' in next(f):
pass
for line in f:
#line will be now the next line after the one that contains 'Abstract'
Just to clarify, your code already "reads" all the lines. To start "paying attention" to lines after a certain point, you can just set a boolean flag to indicate whether or not lines should be ignored, and check it at each line.
pay_attention = False
for line in f:
if pay_attention:
print line
else: # We haven't found our trigger yet; see if it's in this line
if 'Abstract' in line:
pay_attention = True
If you don't mind a little more rearranging of your code, you can also use two partial loops instead: one loop that terminates once you've found your trigger phrase ('Abstract'), and one that reads all following lines. This approach is a little cleaner (and a very tiny bit faster).
for skippable_line in f: # First skim over all lines until we find 'Abstract'.
if 'Abstract' in skippable_line:
break
for line in f: # The file's iterator starts up again right where we left it.
print line
The reason this works is that the file object returned by open behaves like a generator, rather than, say, a list: it only produces values as they are requested. So when the first loop stops, the file is left with its internal position set at the beginning of the first "unread" line. This means that when you enter the second loop, the first line you see is the first line after the one that triggered the break.
Making a guess as to how the dictionary is involved, I'd write it this way:
lines = dict()
for filename in filepath:
with open(filename, 'r') as f:
for line in f:
if 'Abstract' in line:
break
lines[filename] = tuple(f)
So for each file, your dictionary contains a tuple of lines.
This works because the loop reads up to and including the line you identify, leaving the remaining lines in the file ready to be read from f.

parse blocks of text from text file using Python

I am trying to parse some text files and need to extract blocks of text. Specifically, the lines that start with "1:" and 19 lines after the text. The "1:" does not start on the same row in each file and there is only one instance of "1:". I would prefer to save the block of text and export it to a separate file. In addition, I need to preserve the formatting of the text in the original file.
Needless to say I am new to Python. I generally work with R but these files are not really compatible with R and I have about 100 to process. Any information would be appreciated.
The code that I have so far is:
tmp = open(files[0],"r")
lines = tmp.readlines()
tmp.close()
num = 0
a=0
for line in lines:
num += 1
if "1:" in line:
a = num
break
a = num is the line number for the block of text I want. I then want to save to another file the next 19 lines of code, but can't figure how how to do this. Any help would be appreciated.
Here is one option. Read all lines from your file. Iterate till you find your line and return next 19 lines. You would need to handle situations where your file doesn't contain additional 19 lines.
fh = open('yourfile.txt', 'r')
all_lines = fh.readlines()
fh.close()
for count, line in enumerate(all_lines):
if "1:" in line:
return all_lines[count+1:count+20]
Could be done in a one-liner...
open(files[0]).read().split('1:', 1)[1].split('\n')[:19]
or more readable
txt = open(files[0]).read() # read the file into a big string
before, after = txt.split('1:', 1) # split the file on the first "1:"
after_lines = after.split('\n') # create lines from the after text
lines_to_save = after_lines[:19] # grab the first 19 lines after "1:"
then join the lines with a newline (and add a newline to the end) before writing it to a new file:
out_text = "1:" # add back "1:"
out_text += "\n".join(lines_to_save) # add all 19 lines with newlines between them
out_text += "\n" # add a newline at the end
open("outputfile.txt", "w").write(out_text)
to comply with best practice for reading and writing files you should also be using the with statement to ensure that the file handles are closed as soon as possible. You can create convenience functions for it:
def read_file(fname):
"Returns contents of file with name `fname`."
with open(fname) as fp:
return fp.read()
def write_file(fname, txt):
"Writes `txt` to a file named `fname`."
with open(fname, 'w') as fp:
fp.write(txt)
then you can replace the first line above with:
txt = read_file(files[0])
and the last line with:
write_file("outputfile.txt", out_text)
I always prefer to read the file into memory first, but sometimes that's not possible. If you want to use iteration then this will work:
def process_file(fname):
with open(fname) as fp:
for line in fp:
if line.startswith('1:'):
break
else:
return # no '1:' in file
yield line # yield line containing '1:'
for i, line in enumerate(fp):
if i >= 19:
break
yield line
if __name__ == "__main__":
with open('ouput.txt', 'w') as fp:
for line in process_file('intxt.txt'):
fp.write(line)
It's using the else: clause on a for-loop which you don't see very often anymore, but was created for just this purpose (the else clause if executed if the for-loop doesn't break).

Categories

Resources