Random DNA mutation Generator - python

I'd like to create a dictionary of dictionaries for a series of mutated DNA strands, with each dictionary demonstrating the original base as well as the base it has mutated to.
To elaborate, what I would like to do is create a generator that allows one to input a specific DNA strand and have it crank out 100 randomly generated strands that have a mutation frequency of 0.66% (this applies to each base, and each base can mutate to any other base). Then, what I would like to do is create a series of dictionary, where each dictionary details the mutations that occured in a specific randomly generated strand. I'd like the keys to be the original base, and the values to be the new mutated base. Is there a straightforward way of doing this? So far, I've been experimenting with a loop that looks like this:
#yields a strand with an A-T mutation frequency of 0.066%
def mutate(string, mutation, threshold):
dna = list(string)
for index, char in enumerate(dna):
if char in mutation:
if random.random() < threshold:
dna[index] = mutation[char]
return ''.join(dna)
dna = "ATGTCGTACGTTTGACGTAGAG"
print("DNA first:", dna)
newDNA = mutate(dna, {"A": "T"}, 0.0066)
print("DNA now:", newDNA)
But I can only yield one strand with this code, and it only focuses on T-->A mutations. I'm also not sure how to tie the dictionary into this. could someone show me a better way of doing this? Thanks.

It sounds like there are two parts to your issue. The first is that you want to mutate your DNA sequence several times, and the second is that you want to gather some additional information about the mutations in a data structure of some kind. I'll handle each of those separately.
Producing 100 random results from the same source string is pretty easy. You can do it with an explicit loop (for instance, in a generator function), but you can just as easily use a list comprehension to run a single-mutation function over and over:
results = [mutate(original_string) for _ in range(100)]
Of course, if you make the mutate function more complicated, this simple code may not be appropriate. If it returns some kind of more sophisticated data structure, rather than just a string, you may need to do some additional processing to combine the data in the format you want.
As for how to build those data structures, I think the code you have already is a good start. You'll need to decide how exactly you're going to be accessing your data, and then let that guide you to the right kind of container.
For instance, if you just want to have a simple record of all the mutations that happen to a string, I'd suggest a basic list that contains tuples of the base before and after the mutation. On the other hand, if you want to be able to efficiently look up what a given base mutates to, a dictionary with lists as values might be more appropriate. You could also include the index of the mutated base if you wanted to.
Here's a quick attempt at a function that returns the mutated string along with a list of tuples recording all the mutations:
bases = "ACGT"
def mutate(orig_string, mutation_rate=0.0066):
result = []
mutations = []
for base in orig_string:
if random.random() < mutation_rate:
new_base = bases[bases.index(base) - random.randint(1, 3)] # negatives are OK
result.append(new_base)
mutations.append((base, new_base))
else:
result.append(base)
return "".join(result), mutations
The most tricky bit of this code is how I'm picking the replacement of the current base. The expression bases[bases.index(base) - random.randint(1, 3)] does it all in one go. Lets break down the different bits. bases.index(base) gives the index of the previous base in the global bases string at the top of the code. Then I subtract a random offset from this index (random.randint(1, 3)). The new index may be negative, but that's OK, as when we use it to index back into the bases string (bases[...]), negative indexes count from the right, rather than the left.
Here's how you could use it:
string = "ATGT"
results = [mutate(string) for _ in range(100)]
for result_string, mutations in results:
if mutations: # skip writing out unmutated strings
print(result_string, mutations)
For short strings, like "ATGT" you're very unlikely to get more than one mutation, and even one is pretty rare. The loop above tends to print between 2 and 4 results on each run (that is, more than 95% of length-four strings are not mutated at all). Longer strings will have mutations more often, and it's more plausible that you'll see multiple mutations in one string.

Related

Is there a better way than a while loop to perform this function?

I was attempting some python exercises and I hit the 5s timeout on one of the tests. The function is pre-populated with the parameters and I am tasked with writing code that is fast enough to run within the max timeframe of 5s.
There are N dishes in a row on a kaiten belt, with the ith dish being of type Di​. Some dishes may be of the same type as one another. The N dishes will arrive in front of you, one after another in order, and for each one you'll eat it as long as it isn't the same type as any of the previous K dishes you've eaten. You eat very fast, so you can consume a dish before the next one gets to you. Any dishes you choose not to eat as they pass will be eaten by others.
Determine how many dishes you'll end up eating.
Issue
The code "works" but is not fast enough.
Code
The idea here is to add the D[i] entry if it is not in the pastDishes list (which can be of size K).
from typing import List
# Write any import statements here
def getMaximumEatenDishCount(N: int, D: List[int], K: int) -> int:
# Write your code here
numDishes=0
pastDishes=[]
i=0
while (i<N):
if(D[i] not in pastDishes):
numDishes+=1
pastDishes.append(D[i])
if len(pastDishes)>K:
pastDishes.pop(0)
i+=1
return numDishes
Is there a more effective way?
After much trial and error, I have finally found a solution that is fast enough to pass the final case in the puzzle you are working on. My previous code was very neat and quick, however, I have finally found a module with a tool that makes this much faster. Its from collections just as deque is, however it is called Counter.
This was my original code:
def getMaximumEatenDishCount(N: int, D: list, K: int) -> int:
numDishes=lastMod=0
pastDishes=[0]*K
for Dval in D:
if Dval in pastDishes:continue
pastDishes[lastMod] = Dval
numDishes,lastMod = numDishes+1,(lastMod+1)%K
return numDishes
I then implemented Counter like so:
from typing import List
# Write any import statements here
from collections import Counter
def getMaximumEatenDishCount(N: int, D: 'list[int]', K: int) -> int:
eatCount=lastMod = 0
pastDishes=[0]*K
eatenCounts = Counter({0:K})
for Dval in D:
if Dval in eatenCounts:continue
eatCount +=1
eatenCounts[Dval] +=1
val = pastDishes[lastMod]
if eatenCounts[val] <= 1: eatenCounts.pop(val)
else: eatenCounts[val] -= 1
pastDishes[lastMod]=Dval
lastMod = (lastMod+1)%K
return eatCount
Which ended up working quite well. I'm sure you can make it less clunky, but this should work fine on its own.
Some Explanation of what i am doing:
Typically while loops are actually marginally faster than a for loop, however since I need to access the value at an index multiple times if i used it, using a for loop I believe is actually better in this situation. You can see i also initialised the list to the max size it needs to be and am writing over the values instead of popping+appending which saves alot of time. Additionally, as pointed out by #outis, another small improvement was made in my code by using the modulo operator in conjunction with the variable which removes the need for an additional if statement. The Counter is essentially a special dict object that holds a hashable as the key and an int as the value. I use the fact that lastMod is an index to what would normally be accesed through list.pop(0) to access the object needed to either remove or decrement in the counter
Note that it is not considered 'pythonic' to assign multiple variable on one line, however I believe it adds a slight performance boost which is why I have done it. This can be argued though, see this post.
If anyone else is interested the problem that we were trying to solve, it can be found here: https://www.facebookrecruiting.com/portal/coding_puzzles/?puzzle=958513514962507
Can we use an appropriate data structure? If so:
Data structures
Seems like an ordered set which you have to shrink to a capacity restriction of K.
To meet that, if exceeds (len(ordered_set) > K) we have to remove the first n items where n = len(ordered_set) - K. Ideally the removal will perform in O(1).
However since removal on a set is in unordered fashion. We first transform it to a list. A list containing unique elements in the order of appearance in their original sequence.
From that ordered list we can then remove the first n elements.
For example: the function lru returns the least-recently-used items for a sequence seq limited by capacity-limit k.
To obtain the length we can simply call len() on that LRU return value:
maximumEatenDishCount = len(lru(seq, k))
See also:
Does Python have an ordered set?
Fastest way to get sorted unique list in python?
Using set for uniqueness (up to Python 3.6)
def lru(seq, k):
return list(set(seq))[:k]
Using dict for uniqueness (since Python 3.6)
Same mechanics as above, but using the preserved insertion order of dicts since 3.7:
using OrderedDict explicitly
from collections import OrderedDict
def lru(seq, k):
return list(OrderedDict.fromkeys(seq).keys())[:k]
using dict factory-method:
def lru(seq, k):
return list(dict.fromkeys(seq).keys())[:k]
using dict-comprehension:
def lru(seq, k):
return list({i:0 for i in seq}.keys())[:k]
See also:
The order of keys in dictionaries
Using ordered dictionary as ordered set
How do you remove duplicates from a list whilst preserving order?
Real Python: OrderedDict vs dict in Python: The Right Tool for the Job
As the problem is an exercise, exact solutions are not included. Instead, strategies are described.
There are at least a couple potential approaches:
Use a data structure that supports fast containment testing (a set in use, if not in name) limited to the K most recently eaten dishes. Fortunately, since dict preserves insertion order in newer Python versions and testing key containment is fast, it will fit the bill. dict requires that keys be hashable, but since the problem uses ints to represent dish types, that requirement is met.
With this approach, the algorithm in the question remains unchanged.
Rather than checking whether the next dish type is any of the last K dishes, check whether the last time the next dish was eaten is within K of the current plate count. If it is, skip the dish. If not, eat the dish (update both the record of when the next dish was last eaten and the current dish count). In terms of data structures, the program will need to keep a record of when any given dish type was last eaten (initialized to -K-1 to ensure that the first time a dish type is encountered it will be eaten; defaultdict can be very useful for this).
With this approach, the algorithm is slightly different. The code ends up being slightly shorter, as there's no shortening of the data structure storing information about the dishes as there is in the original algorithm.
There are two takeaways from the latter approach that might be applied when solving other problems:
More broadly, reframing a problem (such as from "the dish is in the last K dishes eaten" to "the dish was last eaten within K dishes of now") can result in a simpler approach.
Less broadly, sometimes it's more efficient to work with a flipped data structure, swapping keys/indices and values.
Approach & takeaway 2 both remind me of a substring search algorithm (the name escapes me) that uses a table of positions in the needle (the string to search for) of where each character first appears (for characters not in the string, the table has the length of the string); when a mismatch occurs, the algorithm uses the table to align the substring with the mismatching character, then starts checking at the start of the substring. It's not the most efficient string search algorithm, but it's simple and more efficient than the naive algorithm. It's similar to but simpler and less efficient than the skip search algorithm, which uses the positions of every occurrence of each character in the needle.
from typing import List
# Write any import statements here
from collections import deque, Counter
def getMaximumEatenDishCount(N: int, D: List[int], K: int) -> int:
# Write your code here
q = deque()
cnt = 0
dish_counter = Counter()
for d in D:
if dish_counter[d] == 0:
cnt += 1
q.append(d)
dish_counter[d] += 1
if len(q) == K + 1:
remove = q.popleft()
dish_counter[remove] -= 1
return cnt

How to deal with parsing an arbitrary number of lists into a dictionary

I am parsing an XMI/XML data structure into a pandas dataframe by first decomposing it into a dictionary. When I encounter a named tuple in a list in my XMI, there appear to be a maximum of two named tuples in my list (although the majority only have one).
To handle this case, I am doing the following:
if val is not None and val:
if len(val) == 1:
d['modifiedBegin'] = val[0].begin
d['modifiedEnd'] = val[0].end
d['modifiedBegin1'] = None
d['modifiedEnd1'] = None
else:
d['modifiedBegin1'] = val[1].begin
d['modifiedEnd1'] = val[1].end
My issues with this are: a) I cannot be guaranteed that there are only two lists in my list that I am decomposing, and b) this feels cheap, ugly and just plain wrong!
I really would like to come up with a more general solution, especially given item a) above.
My data look like:
val = [Span(xmiID=105682, begin=13352, end=13358, type='org.metamap.uima.ts.Span'), Span(xmiID=105685, begin=13368, end=13374, type='org.metamap.uima.ts.Span')]
I would really much rather parse this out into two separate rows in my dataframe, instead of having more columns. The major issue is that both of these tuples share common data from a larger object that looks like:
Negation(xmiID=142613, id=None, negType='nega', negTrigger='without', modifier=[Span(xmiID=105682, begin=13352, end=13358, type='org.metamap.uima.ts.Span'), Span(xmiID=105685, begin=13368, end=13374, type='org.metamap.uima.ts.Span')])
So, both rows share the attributes negType and negTrigger... what is a more general way of decomposing this to insert into my dataframe. I though of iterating through the elements when the length of the list ws greater than one and then inserting into the datframe on each iteration, but that seems messy.
My desired outcome would thus be to have a dataframe that looks like (minus the indices and other common junk):
Iterate over Negation namedtuples
for each thing in negation.modifier
add a row using the negation attributes and the things attributes
Or instead of parsing XML to namedtuples to dictionaries skip the middle part and create a single dictionary - {'begin':[row0,row1,...],'end':[row0,row1,...],'negtrigger':[row0,row1,...],'negtype':[row0,row1,...]} - from the XML

Use a list to check an array index

In python, I am generating lists to represent states (for example a state could be [1,3,2,2,5]).
The value of each element can range from 1 to some specific number.
Based on certain rules, these states can evolve in particular ways. I am not interested in states I have already encountered.
Right now my code just checks whether a list is in a list of lists and if it isn't, it appends it. But this list is getting very large and using a lot of resources to check against.
I would like to
create a multidimensional array of zeros,
check a particular location in that array, and if that location is 0 set it to 1.
If I take the state stored as a list or as an array, adjust it by 1
to correspond to index values, and try to pass that value as an index
for the zeros array, it doesn't just change the one element.
I think this is because the list is in brackets, where index() wants an
argument of just integers separated by commas.
Is there a way to pass a list or array of integers to check an index of an array that won't add complication to my code? Or even just some more efficient way to
store and check the states I have already generated?
Yes, you may define a class of your state and use define its hash function. In this way, the running time of a lookup reduce to O(1) and the space required reduce to O(N), where N is the number of states instead of number of state * state size
A sample class of the state:
class State(object):
def __init__(self, state_array):
self.state_array = state_array
def getHash(self):
return hash(self.state_array) # using python default hash function here, you can totally design your own.
When storing current state:
# current_state is the state you currently have
all_states = {}
if current_state.getHash() not in all_state:
all_states[current_state.getHash()] = 1
else:
# Do something else
Note that in python, element in dict takes O(1) because a dict in python is actually a hashmap.
You should maintain the states you have already encountered in a set. This ensures that a contains check (state in visited) is O(1), and not O(N). Since lists are not hashable, you would have to convert them to tuples, or use tuples in the first place:
visited = set()
states = [[1,3,2,2,5], [...], ...]
for state in states:
tpl = tuple(state)
if tpl not in visited: # instant check no matter the size of visted
# process state
visited.add(tpl)
Your idea of creating this 5-dimensional list and passing the state values as indexes is valid, but would create a large (n^5 n: number of values for each slot) and presumably sparse and therefore waisteful matrix.
BTW, You access a slot in such a matrix via m[1][3][2][2][5], not m.index([1,3,2,2,5]).

Optimised Python dictionary / negative index storage

Raised by this question's comments (I can see that this is irrelevant), I am now aware that using dictionaries for data that needs to be queried/accessed regularly is not good, speedwise.
I have a situation of something like this:
someDict = {}
someDict[(-2, -2)] = something
somedict[(3, -10)] = something else
I am storing keys of coordinates to objects that act as arrays of tiles in a game. These are going to be negative at some point, so I can't use a list or some kind of sparse array (I think that's the term?).
Can I either:
Speed up dictionary lookups, so this would not be an issue
Find some kind of container that will support sparse, negative indices?
I would use a list, but then the querying would go from O(log n) to O(n) to find the area at (x, y). (I think my timings are off here too).
Python dictionaries are very very fast, and using a tuple of integers is not going to be a problem. However your use case seems that sometimes you need to do a single-coordinate check and doing that traversing all the dict is of course slow.
Instead of doing a linear search you can however speed up the data structure for the access you need using three dictionaries:
class Grid(object):
def __init__(self):
self.data = {} # (i, j) -> data
self.cols = {} # i -> set of j
self.rows = {} # j -> set of i
def __getitem__(self, ij):
return self.data[ij]
def __setitem__(self, ij, value):
i, j = ij
self.data[ij] = value
try:
self.cols[i].add(j)
except KeyError:
self.cols[i] = set([j])
try:
self.rows[j].add(i)
except KeyError:
self.rows[j] = add([i])
def getRow(self, i):
return [(i, j, data[(i, j)])
for j in self.cols.get(i, [])]
def getCol(self, j):
return [(i, j, data[(i, j)])
for i in self.rows.get(j, [])]
Note that there are many other possible data structures depending on exactly what you are trying to do, how frequent is reading, how frequent is updating, if you query by rectangles, if you look for nearest non-empty cell and so on.
To start off with
Speed up dictionary lookups, so this would not be an issue
Dictionary lookups are pretty fast O(1), but (from your other question) you're not relying on the hash-table lookup of the dictionary, your relying on a linear search of the dictionary's keys.
Find some kind of container that will support sparse, negative indices?
This isn't indexing into the dictionary. A tuple is an immutable object, and you are hashing the tuple as a whole. The dictionary really has no idea of the contents of the keys, just their hash.
I'm going to suggest, as others did, that you restructure your data.
For example, you could create objects that encapsulate the data you need, and arrange them in a binary tree for O(n lg n) searches. You can even go so far as to wrap the entire thing in a class that will give you the nice if foo in Bar: syntax your looking for.
You probably need a couple coordinated structures to accomplish what you want. Here's a simplified example using dicts and sets (tweaking user 6502's suggestion a bit).
# this will be your dict that holds all the data
matrix = {}
# and each of these will be a dict of sets, pointing to coordinates
cols = {}
rows = {}
def add_data(coord, data)
matrix[coord] = data
try:
cols[coord[0]].add(coord)
except KeyError:
# wrap coords in a list to prevent set() from iterating over it
cols[coord[0]] = set([coord])
try:
rows[coord[1]].add(coord)
except KeyError:
rows[coord[1]] = set([coord])
# now you can find all coordinates from a row or column quickly
>>> add_data((2, 7), "foo4")
>>> add_data((2, 5), "foo3")
>>> 2 in cols
True
>>> 5 in rows
True
>>> [matrix[coord] for coord in cols[2]]
['foo4', 'foo3']
Now just wrap that in a class or a module, and you'll be off, and as always, if it's not fast enough profile and test before you guess.
Dictionary lookups are very fast. Searching for part of the key (e.g. all tiles in row x) is what's not fast. You could use a dict of dicts. Rather than a single dict indexed by a 2-tuple, use nested dicts like this:
somedict = {0: {}, 1:{}}
somedict[0][-5] = "thingy"
somedict[1][4] = "bing"
Then if you want all the tiles in a given "row" it's just somedict[0].
You will need some logic to add the secondary dictionaries where necessary and so on. Hint: check out getitem() and setdefault() on the standard dict type, or possibly the collections.defaultdict type.
This approach gives you quick access to all tiles in a given row. It's still slow-ish if you want all the tiles in a given column (though at least you won't need to look through every single cell, just every row). However, if needed, you could get around that by having two dicts of dicts (one in column, row order and the other in row, column order). Updating then becomes twice as much work, which may not matter for a game where most of the tiles are static, but access is very easy in either direction.
If you only need to store numbers and most of your cells will be 0, check out scipy's sparse matrix classes.
One alternative would be to simply shift the index so it's positive.
E.g. if your indices are contiguous like this:
...
-2 -> a
-1 -> c
0 -> d
1 -> e
2 -> f
...
Just do something like LookupArray[Index + MinimumIndex], where MinimumIndex is the absolute value of the smallest index you would use.
That way, if your minimum was say, -50, it would map to 0. -20 would map to 30, and so forth.
Edit:
An alternative would be to use a trick with how you use the indices. Define the following key function
Key(n) = 2 * n (n >= 0)
Key(n) = -2 * n - 1. (n < 0)
This maps all positive keys to the positive even indices, and all negative elements to the positive odd indices. This may not be practical though, since if you add 100 negative keys, you'd have to expand your array by 200.
One other thing to note: If you plan on doing look ups and the number of keys is constant (or very slowly changing), stick with an array. Otherwise, dictionaries aren't bad at all.
Use multi-dimensional lists -- usually implemented as nested objects. You can easily make this handle negative indices with a little arithmetic. It might use a more memory than a dictionary since something has to be put in every possible slot (usually None for empty ones), but access will be done via simple indexing lookup rather than hashing as it would with a dictionary.

Comparing massive lists of dictionaries in python

I never actually thought I'd run into speed-issues with python, but I have. I'm trying to compare really big lists of dictionaries to each other based on the dictionary values. I compare two lists, with the first like so
biglist1=[{'transaction':'somevalue', 'id':'somevalue', 'date':'somevalue' ...}, {'transactio':'somevalue', 'id':'somevalue', 'date':'somevalue' ...}, ...]
With 'somevalue' standing for a user-generated string, int or decimal. Now, the second list is pretty similar, except the id-values are always empty, as they have not been assigned yet.
biglist2=[{'transaction':'somevalue', 'id':'', 'date':'somevalue' ...}, {'transactio':'somevalue', 'id':'', 'date':'somevalue' ...}, ...]
So I want to get a list of the dictionaries in biglist2 that match the dictionaries in biglist1 for all other keys except id.
I've been doing
for item in biglist2:
for transaction in biglist1:
if item['transaction'] == transaction['transaction']:
list_transactionnamematches.append(transaction)
for item in biglist2:
for transaction in list_transactionnamematches:
if item['date'] == transaction['date']:
list_transactionnamematches.append(transaction)
... and so on, not comparing id values, until I get a final list of matches. Since the lists can be really big (around 3000+ items each), this takes quite some time for python to loop through.
I'm guessing this isn't really how this kind of comparison should be done. Any ideas?
Index on the fields you want to use for lookup. O(n+m)
matches = []
biglist1_indexed = {}
for item in biglist1:
biglist1_indexed[(item["transaction"], item["date"])] = item
for item in biglist2:
if (item["transaction"], item["date"]) in biglist1_indexed:
matches.append(item)
This is probably thousands of times faster than what you're doing now.
What you want to do is to use correct data structures:
Create a dictionary of mappings of tuples of other values in the first dictionary to their id.
Create two sets of tuples of values in both dictionaries. Then use set operations to get the tuple set you want.
Use the dictionary from the point 1 to assign ids to those tuples.
Forgive my rusty python syntax, it's been a while, so consider this partially pseudocode
import operator
biglist1.sort(key=(operator.itemgetter(2),operator.itemgetter(0)))
biglist2.sort(key=(operator.itemgetter(2),operator.itemgetter(0)))
i1=0;
i2=0;
while i1 < len(biglist1) and i2 < len(biglist2):
if (biglist1[i1]['date'],biglist1[i1]['transaction']) == (biglist2[i2]['date'],biglist2[i2]['transaction']):
biglist3.append(biglist1[i1])
i1++
i2++
elif (biglist1[i1]['date'],biglist1[i1]['transaction']) < (biglist2[i2]['date'],biglist2[i2]['transaction']):
i1++
elif (biglist1[i1]['date'],biglist1[i1]['transaction']) > (biglist2[i2]['date'],biglist2[i2]['transaction']):
i2++
else:
print "this wont happen if i did the tuple comparison correctly"
This sorts both lists into the same order, by (date,transaction). Then it walks through them side by side, stepping through each looking for relatively adjacent matches. It assumes that (date,transaction) is unique, and that I am not completely off my rocker with regards to tuple sorting and comparison.
In O(m*n)...
for item in biglist2:
for transaction in biglist1:
if (item['transaction'] == transaction['transaction'] &&
item['date'] == transaction['date'] &&
item['foo'] == transaction['foo'] ) :
list_transactionnamematches.append(transaction)
The approach I would probably take to this is to make a very, very lightweight class with one instance variable and one method. The instance variable is a pointer to a dictionary; the method overrides the built-in special method __hash__(self), returning a value calculated from all the values in the dictionary except id.
From there the solution seems fairly obvious: Create two initially empty dictionaries: N and M (for no-matches and matches.) Loop over each list exactly once, and for each of these dictionaries representing a transaction (let's call it a Tx_dict), create an instance of the new class (a Tx_ptr). Then test for an item matching this Tx_ptr in N and M: if there is no matching item in N, insert the current Tx_ptr into N; if there is a matching item in N but no matching item in M, insert the current Tx_ptr into M with the Tx_ptr itself as a key and a list containing the Tx_ptr as the value; if there is a matching item in N and in M, append the current Tx_ptr to the value associated with that key in M.
After you've gone through every item once, your dictionary M will contain pointers to all the transactions which match other transactions, all neatly grouped together into lists for you.
Edit: Oops! Obviously, the correct action if there is a matching Tx_ptr in N but not in M is to insert a key-value pair into M with the current Tx_ptr as the key and as the value, a list of the current Tx_ptr and the Tx_ptr that was already in N.
Have a look at Psyco. Its a Python compiler that can create very fast, optimized machine code from your source.
http://sourceforge.net/projects/psyco/
While this isn't a direct solution to your code's efficiency issues, it could still help speed things up without needing to write any new code. That said, I'd still highly recommend optimizing your code as much as possible AND use Psyco to squeeze as much speed out of it as possible.
Part of their guide specifically talks about using it to speed up list, string, and numeric computation heavy functions.
http://psyco.sourceforge.net/psycoguide/node8.html
I'm also a newbie. My code is structured in much the same way as his.
for A in biglist:
for B in biglist:
if ( A.get('somekey') <> B.get('somekey') and #don't match to itself
len( set(A.get('list')) - set(B.get('list')) ) > 10:
[do stuff...]
This takes hours to run through a list of 10000 dictionaries. Each dictionary contains lots of stuff but I could potentially pull out just the ids ('somekey') and lists ('list') and rewrite as a single dictionary of 10000 key:value pairs.
Question: how much faster would that be? And I assume this is faster than using a list of lists, right?

Categories

Resources