I am used to do scripting in bash, but I am also learning python.
So, as a way of learning, I am trying to modify my few old bash in python. As, say,I have a file, with line like:
TOTDOS= 0.38384E+02n_Ef= 0.81961E+02 Ebnd 0.86883E+01
to get the value of TOTDOS in bash, I just do:
grep "TOTDOS=" 630/out-Dy-eos2|head -c 19|tail -c 11
but by python, I am doing:
#!/usr/bin/python3
import re
import os.path
import sys
f1 = open("630/out-Dy-eos2", "r")
re1 = r'TOTDOS=\s*(.*)n_Ef=\s*(.*)\sEbnd'
for line in f1:
match1 = re.search(re1, line)
if match1:
TD = (match1.group(1))
f1.close()
print(TD)
Which is surely giving correct result, but seems to be much more then bash(not to mention problem with regex).
Question is, am I overworking in python, or missing something of it?
A python script that matches your bash line would be more like this:
with open('630/out-Dy-eos2', 'r') as f1:
for line in f1:
if "TOTDOS=" in line:
print line[8:19]
Looks a little bit better now.
[...] but seems to be much more than bash
Maybe (?) generators are the closest Python concept to the "pipe filtering" used in shell.
import itertools
#
# Simple generator to iterate through a file
# equivalent of line by line reading from an input file
def source(fname):
with open(fname,"r") as f:
for l in f:
yield l
src = source("630/out-Dy-eos2")
# First filter to keep only lines containing the required word
# equivalent to `grep -F`
filter1 = (l for l in src if "TOTDOS=" in l)
# Second filter to keep only line in the required range
# equivalent of `head -n ... | tail -n ...`
filter2 = itertools.islice(filter1, 10, 20,1)
# Finally output
output = "".join(filter2)
print(output)
Concerning your specific example, if you need it, you could use regexp in a generator:
re1 = r'TOTDOS=\s*(.*)n_Ef=\s*(.*)\sEbnd'
filter1 = (m.group(1) for m in (re.match(re1, l) for l in src) if m)
Those are only (some of the) basic building blocs available to you.
Related
I have two fasta files, and I want to search for sequence IDs and assign only the sequence corresponding to the ID to a string in Python.
I currently have:
import os
#use awk on the command line to search reference file and cut the reference sequence
os.system("awk '/LOC_OS05G45410.1/{getline;print}' Ref_seqs.fasta > sangerRef")
#use awk on the command line to cut the aligned sequence
os.system("awk '/seq1/{getline;print}' Sanger_seq_1.fasta > sangerAlign")
Ref_seq = open('sangerRef', 'r').read()
Sanger_seq = open('sangerAlign', 'r').read()
When I print these variables, everything looks fine:
TGGTGAGGCTTTTGACAGGGTTGAGCTGAGCCTGGTCTCCCTGGAGAAACTCTTCCAGAGAGCAAATGATGCTTGCACAGCTGCTGAAGAAATGTACTCCCATGGTCATGGTGGTACTGAACCCAG
CTGCTGCCCAAGTACTTCAAGCACAACAACTTCTCCAGCTTCATCAGGCAGCTCAACGCCTACGGTTTCCGAAAAATCGATCCTGAGAGATGGGAGTTCGCAAACGAGGATTTCATAAGAGGGCACACGCACCTT
However, when I try to read these variables into another function, it doesn't work:
from Bio import pairwise2
from Bio.Align import substitution_matrices
#load sequences
s1=Ref_seq
s2=Sanger_seq
matrix = substitution_matrices.load("NUC.4.4")
gap_open = -10
gap_extend = -0.5
align = pairwise2.align.globalds(s1, s2, matrix, gap_open, gap_extend)
align
I'm thinking it might be better to replace the awk command with a Python command?
I think it's because you haven't parsed the sequences. I don't know if I am using the word 'Parse' right, though.
I think this should work
from Bio import SeqIO
s1 = SeqIO.read('filepath/filename.fasta','fasta')
s2 = SeqIO.read('filepath/file.fasta','fasta')
matrix = substitution_matrices.load("NUC.4.4")
gap_open = -10
gap_extend = -0.5
align = pairwise2.align.globalds(s1.seq, s2.seq, matrix, gap_open, gap_extend)
align
The immediate problem is that read() returns all the lines with a newline at the end of each.
But indeed, your Awk commands should be trivial to replace with native Python.
def getseq(filename, search):
with open(filename) as reffile:
for line in reffile:
if search in line:
return seqfile.__next__().rstrip('\n')
s1 = getseq("Ref_seqs.fasta", "LOC_OS05G45410.1")
s2 = getseq("Sanger_seq_1.fasta", "seq1")
Probably BioPython already contains a better function for doing this. In particular, your Awk script (and hence this blind reimplementation) assumes that each sequence only occupies one line in the file.
I'm a python learner. If I have a lines of text in a file that looks like this
"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"
Can I split the lines around the inverted commas? The only constant would be their position in the file relative to the data lines themselves. The data lines could range from 10 to 100+ characters (they'll be nested network folders). I cannot see how I can use any other way to do those markers to split on, but my lack of python knowledge is making this difficult.
I've tried
optfile=line.split("")
and other variations but keep getting valueerror: empty seperator. I can see why it's saying that, I just don't know how to change it. Any help is, as always very appreciated.
Many thanks
You must escape the ":
input.split("\"")
results in
['\n',
'Y:\\DATA\x0001\\SERVER\\DATA.TXT',
' ',
'V:\\DATA2\x0002\\SERVER2\\DATA2.TXT',
'\n']
To drop the resulting empty lines:
[line for line in [line.strip() for line in input.split("\"")] if line]
results in
['Y:\\DATA\x0001\\SERVER\\DATA.TXT', 'V:\\DATA2\x0002\\SERVER2\\DATA2.TXT']
I'll just add that if you were dealing with lines that look like they could be command line parameters, then you could possibly take advantage of the shlex module:
import shlex
with open('somefile') as fin:
for line in fin:
print shlex.split(line)
Would give:
['Y:\\DATA\\00001\\SERVER\\DATA.TXT', 'V:\\DATA2\\00002\\SERVER2\\DATA2.TXT']
No regex, no split, just use csv.reader
import csv
sample_line = '10.0.0.1 foo "24/Sep/2015:01:08:16 +0800" www.google.com "GET /" -'
def main():
for l in csv.reader([sample_line], delimiter=' ', quotechar='"'):
print l
The output is
['10.0.0.1', 'foo', '24/Sep/2015:01:08:16 +0800', 'www.google.com', 'GET /', '-']
shlex module can help you.
import shlex
my_string = '"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"'
shlex.split(my_string)
This will spit
['Y:\\DATA\x0001\\SERVER\\DATA.TXT', 'V:\\DATA2\x0002\\SERVER2\\DATA2.TXT']
Reference: https://docs.python.org/2/library/shlex.html
Finding all regular expression matches will do it:
input=r'"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"'
re.findall('".+?"', # or '"[^"]+"', input)
This will return the list of file names:
["Y:\DATA\00001\SERVER\DATA.TXT", "V:\DATA2\00002\SERVER2\DATA2.TXT"]
To get the file name without quotes use:
[f[1:-1] for f in re.findall('".+?"', input)]
or use re.finditer:
[f.group(1) for f in re.finditer('"(.+?)"', input)]
The following code splits the line at each occurrence of the inverted comma character (") and removes empty strings and those consisting only of whitespace.
[s for s in line.split('"') if s.strip() != '']
There is no need to use regular expressions, an escape character, some module or assume a certain number of whitespace characters between the paths.
Test:
line = r'"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"'
output = [s for s in line.split('"') if s.strip() != '']
print(output)
>>> ['Y:\\DATA\\00001\\SERVER\\DATA.TXT', 'V:\\DATA2\\00002\\SERVER2\\DATA2.TXT']
I think what you want is to extract the filepaths, which are separated by spaces. That is you want to split the line about items contained within quotations. I.e with a line
"FILE PATH" "FILE PATH 2"
You want
["FILE PATH","FILE PATH 2"]
In which case:
import re
with open('file.txt') as f:
for line in f:
print(re.split(r'(?<=")\s(?=")',line))
With file.txt:
"Y:\DATA\00001\SERVER\DATA MINER.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"
Outputs:
>>>
['"Y:\\DATA\\00001\\SERVER\\DATA MINER.TXT"', '"V:\\DATA2\\00002\\SERVER2\\DATA2.TXT"']
This was my solution. It parses most sane input exactly the same as if it was passed into the command line directly.
import re
def simpleParse(input_):
def reduce_(quotes):
return '' if quotes.group(0) == '"' else '"'
rex = r'("[^"]*"(?:\s|$)|[^\s]+)'
return [re.sub(r'"{1,2}',reduce_,z.strip()) for z in re.findall(rex,input_)]
Use case: Collecting a bunch of single shot scripts into a utility launcher without having to redo command input much.
Edit:
Got OCD about the stupid way that the command line handles crappy quoting and wrote the below:
import re
tokens = list()
reading = False
qc = 0
lq = 0
begin = 0
for z in range(len(trial)):
char = trial[z]
if re.match(r'[^\s]', char):
if not reading:
reading = True
begin = z
if re.match(r'"', char):
begin = z
qc = 1
else:
begin = z - 1
qc = 0
lc = begin
else:
if re.match(r'"', char):
qc = qc + 1
lq = z
elif reading and qc % 2 == 0:
reading = False
if lq == z - 1:
tokens.append(trial[begin + 1: z - 1])
else:
tokens.append(trial[begin + 1: z])
if reading:
tokens.append(trial[begin + 1: len(trial) ])
tokens = [re.sub(r'"{1,2}',lambda y:'' if y.group(0) == '"' else '"', z) for z in tokens]
I know this got answered a million year ago, but this works too:
input = '"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"'
input = input.replace('" "','"').split('"')[1:-1]
Should output it as a list containing:
['Y:\\DATA\x0001\\SERVER\\DATA.TXT', 'V:\\DATA2\x0002\\SERVER2\\DATA2.TXT']
My question Python - Error Caused by Space in argv Arument was marked as a duplicate of this one. We have a number of Python books doing back to Python 2.3. The oldest referred to using a list for argv, but with no example, so I changed things to:-
repoCmd = ['Purchaser.py', 'task', repoTask, LastDataPath]
SWCore.main(repoCmd)
and in SWCore to:-
sys.argv = args
The shlex module worked but I prefer this.
I have a file named sample.txt which looks like below
ServiceProfile.SharediFCList[1].DefaultHandling=1
ServiceProfile.SharediFCList[1].ServiceInformation=
ServiceProfile.SharediFCList[1].IncludeRegisterRequest=n
ServiceProfile.SharediFCList[1].IncludeRegisterResponse=n
Here my requirement is to remove the brackets and the integer and enter os commands with that
ServiceProfile.SharediFCList.DefaultHandling=1
ServiceProfile.SharediFCList.ServiceInformation=
ServiceProfile.SharediFCList.IncludeRegisterRequest=n
ServiceProfile.SharediFCList.IncludeRegisterResponse=n
I am quite a newbie in Python. This is my first attempt. I have used these codes to remove the brackets:
#!/usr/bin/python
import re
import os
import sys
f = os.open("sample.txt", os.O_RDWR)
ret = os.read(f, 10000)
os.close(f)
print ret
var1 = re.sub("[\(\[].*?[\)\]]", "", ret)
print var1f = open("removed.cfg", "w+")
f.write(var1)
f.close()
After this using the file as input I want to form application specific commands which looks like this:
cmcli INS "DefaultHandling=1 ServiceInformation="
and the next set as
cmcli INS "IncludeRegisterRequest=n IncludeRegisterRequest=y"
so basically now I want the all the output to be bunched to a set of two for me to execute the commands on the operating system.
Is there any way that I could bunch them up as set of two?
Reading 10,000 bytes of text into a string is really not necessary when your file is line-oriented text, and isn't scalable either. And you need a very good reason to be using os.open() instead of open().
So, treat your data as the lines of text that it is, and every two lines, compose a single line of output.
from __future__ import print_function
import re
command = [None,None]
cmd_id = 1
bracket_re = re.compile(r".+\[\d\]\.(.+)")
# This doesn't just remove the brackets: what you actually seem to want is
# to pick out everything after [1]. and ignore the rest.
with open("removed_cfg","w") as outfile:
with open("sample.txt") as infile:
for line in infile:
m = bracket_re.match(line)
cmd_id = 1 - cmd_id # gives 0, 1, 0, 1
command[cmd_id] = m.group(1)
if cmd_id == 1: # we have a pair
output_line = """cmcli INS "{0} {1}" """.format(*command)
print (output_line, file=outfile)
This gives the output
cmcli INS "DefaultHandling=1 ServiceInformation="
cmcli INS "IncludeRegisterRequest=n IncludeRegisterResponse=n"
The second line doesn't correspond to your sample output. I don't know how the input IncludeRegisterResponse=n is supposed to become the output IncludeRegisterRequest=y. I assume that's a mistake.
Note that this code depends on your input data being precisely as you describe it and has no error checking whatsoever. So if the format of the input is in reality more variable than that, then you will need to add some validation.
I'm a python learner. If I have a lines of text in a file that looks like this
"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"
Can I split the lines around the inverted commas? The only constant would be their position in the file relative to the data lines themselves. The data lines could range from 10 to 100+ characters (they'll be nested network folders). I cannot see how I can use any other way to do those markers to split on, but my lack of python knowledge is making this difficult.
I've tried
optfile=line.split("")
and other variations but keep getting valueerror: empty seperator. I can see why it's saying that, I just don't know how to change it. Any help is, as always very appreciated.
Many thanks
You must escape the ":
input.split("\"")
results in
['\n',
'Y:\\DATA\x0001\\SERVER\\DATA.TXT',
' ',
'V:\\DATA2\x0002\\SERVER2\\DATA2.TXT',
'\n']
To drop the resulting empty lines:
[line for line in [line.strip() for line in input.split("\"")] if line]
results in
['Y:\\DATA\x0001\\SERVER\\DATA.TXT', 'V:\\DATA2\x0002\\SERVER2\\DATA2.TXT']
I'll just add that if you were dealing with lines that look like they could be command line parameters, then you could possibly take advantage of the shlex module:
import shlex
with open('somefile') as fin:
for line in fin:
print shlex.split(line)
Would give:
['Y:\\DATA\\00001\\SERVER\\DATA.TXT', 'V:\\DATA2\\00002\\SERVER2\\DATA2.TXT']
No regex, no split, just use csv.reader
import csv
sample_line = '10.0.0.1 foo "24/Sep/2015:01:08:16 +0800" www.google.com "GET /" -'
def main():
for l in csv.reader([sample_line], delimiter=' ', quotechar='"'):
print l
The output is
['10.0.0.1', 'foo', '24/Sep/2015:01:08:16 +0800', 'www.google.com', 'GET /', '-']
shlex module can help you.
import shlex
my_string = '"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"'
shlex.split(my_string)
This will spit
['Y:\\DATA\x0001\\SERVER\\DATA.TXT', 'V:\\DATA2\x0002\\SERVER2\\DATA2.TXT']
Reference: https://docs.python.org/2/library/shlex.html
Finding all regular expression matches will do it:
input=r'"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"'
re.findall('".+?"', # or '"[^"]+"', input)
This will return the list of file names:
["Y:\DATA\00001\SERVER\DATA.TXT", "V:\DATA2\00002\SERVER2\DATA2.TXT"]
To get the file name without quotes use:
[f[1:-1] for f in re.findall('".+?"', input)]
or use re.finditer:
[f.group(1) for f in re.finditer('"(.+?)"', input)]
The following code splits the line at each occurrence of the inverted comma character (") and removes empty strings and those consisting only of whitespace.
[s for s in line.split('"') if s.strip() != '']
There is no need to use regular expressions, an escape character, some module or assume a certain number of whitespace characters between the paths.
Test:
line = r'"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"'
output = [s for s in line.split('"') if s.strip() != '']
print(output)
>>> ['Y:\\DATA\\00001\\SERVER\\DATA.TXT', 'V:\\DATA2\\00002\\SERVER2\\DATA2.TXT']
I think what you want is to extract the filepaths, which are separated by spaces. That is you want to split the line about items contained within quotations. I.e with a line
"FILE PATH" "FILE PATH 2"
You want
["FILE PATH","FILE PATH 2"]
In which case:
import re
with open('file.txt') as f:
for line in f:
print(re.split(r'(?<=")\s(?=")',line))
With file.txt:
"Y:\DATA\00001\SERVER\DATA MINER.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"
Outputs:
>>>
['"Y:\\DATA\\00001\\SERVER\\DATA MINER.TXT"', '"V:\\DATA2\\00002\\SERVER2\\DATA2.TXT"']
This was my solution. It parses most sane input exactly the same as if it was passed into the command line directly.
import re
def simpleParse(input_):
def reduce_(quotes):
return '' if quotes.group(0) == '"' else '"'
rex = r'("[^"]*"(?:\s|$)|[^\s]+)'
return [re.sub(r'"{1,2}',reduce_,z.strip()) for z in re.findall(rex,input_)]
Use case: Collecting a bunch of single shot scripts into a utility launcher without having to redo command input much.
Edit:
Got OCD about the stupid way that the command line handles crappy quoting and wrote the below:
import re
tokens = list()
reading = False
qc = 0
lq = 0
begin = 0
for z in range(len(trial)):
char = trial[z]
if re.match(r'[^\s]', char):
if not reading:
reading = True
begin = z
if re.match(r'"', char):
begin = z
qc = 1
else:
begin = z - 1
qc = 0
lc = begin
else:
if re.match(r'"', char):
qc = qc + 1
lq = z
elif reading and qc % 2 == 0:
reading = False
if lq == z - 1:
tokens.append(trial[begin + 1: z - 1])
else:
tokens.append(trial[begin + 1: z])
if reading:
tokens.append(trial[begin + 1: len(trial) ])
tokens = [re.sub(r'"{1,2}',lambda y:'' if y.group(0) == '"' else '"', z) for z in tokens]
I know this got answered a million year ago, but this works too:
input = '"Y:\DATA\00001\SERVER\DATA.TXT" "V:\DATA2\00002\SERVER2\DATA2.TXT"'
input = input.replace('" "','"').split('"')[1:-1]
Should output it as a list containing:
['Y:\\DATA\x0001\\SERVER\\DATA.TXT', 'V:\\DATA2\x0002\\SERVER2\\DATA2.TXT']
My question Python - Error Caused by Space in argv Arument was marked as a duplicate of this one. We have a number of Python books doing back to Python 2.3. The oldest referred to using a list for argv, but with no example, so I changed things to:-
repoCmd = ['Purchaser.py', 'task', repoTask, LastDataPath]
SWCore.main(repoCmd)
and in SWCore to:-
sys.argv = args
The shlex module worked but I prefer this.
I have a text file which a lot of random occurrences of the string #STRING_A, and I would be interested in writing a short script which removes only some of them. Particularly one that scans the file and once it finds a line which starts with this string like
#STRING_A
then checks if 3 lines backwards there is another occurrence of a line starting with the same string, like
#STRING_A
#STRING_A
and if it happens, to delete the occurrence 3 lines backward. I was thinking about bash, but I do not know how to "go backwards" with it. So I am sure that this is not possible with bash. I also thought about python, but then I should store all information in memory in order to go backwards and then, for long files it would be unfeasible.
What do you think? Is it possible to do it in bash or python?
Thanks
Funny that after all these hours nobody's yet given a solution to the problem as actually phrased (as #John Machin points out in a comment) -- remove just the leading marker (if followed by another such marker 3 lines down), not the whole line containing it. It's not hard, of course -- here's a tiny mod as needed of #truppo's fun solution, for example:
from itertools import izip, chain
f = "foo.txt"
for third, line in izip(chain(" ", open(f)), open(f)):
if third.startswith("#STRING_A") and line.startswith("#STRING_A"):
line = line[len("#STRING_A"):]
print line,
Of course, in real life, one would use an iterator.tee instead of reading the file twice, have this code in a function, not repeat the marker constant endlessly, &c;-).
Of course Python will work as well. Simply store the last three lines in an array and check if the first element in the array is the same as the value you are currently reading. Then delete the value and print out the current array. You would then move over your elements to make room for the new value and repeat. Of course when the array is filled you'd have to make sure to continue to move values out of the array and put in the newly read values, stopping to check each time to see if the first value in the array matches the value you are currently reading.
Here is a more fun solution, using two iterators with a three element offset :)
from itertools import izip, chain, tee
f1, f2 = tee(open("foo.txt"))
for third, line in izip(chain(" ", f1), f2):
if not (third.startswith("#STRING_A") and line.startswith("#STRING_A")):
print line,
Why shouldn't it possible in bash? You don't need to keep the whole file in memory, just the last three lines (if I understood correctly), and write what's appropriate to standard-out. Redirect that into a temporary file, check that everything worked as expected, and overwrite the source file with the temporary one.
Same goes for Python.
I'd provide a script of my own, but that wouldn't be tested. ;-)
As AlbertoPL said, store lines in a fifo for later use--don't "go backwards". For this I would definitely use python over bash+sed/awk/whatever.
I took a few moments to code this snippet up:
from collections import deque
line_fifo = deque()
for line in open("test"):
line_fifo.append(line)
if len(line_fifo) == 4:
# "look 3 lines backward"
if line_fifo[0] == line_fifo[-1] == "#STRING_A\n":
# get rid of that match
line_fifo.popleft()
else:
# print out the top of the fifo
print line_fifo.popleft(),
# don't forget to print out the fifo when the file ends
for line in line_fifo: print line,
This code will scan through the file, and remove lines starting with the marker. It only keeps only three lines in memory by default:
from collections import deque
def delete(fp, marker, gap=3):
"""Delete lines from *fp* if they with *marker* and are followed
by another line starting with *marker* *gap* lines after.
"""
buf = deque()
for line in fp:
if len(buf) < gap:
buf.append(line)
else:
old = buf.popleft()
if not (line.startswith(marker) and old.startswith(marker)):
yield old
buf.append(line)
for line in buf:
yield line
I've tested it with:
>>> from StringIO import StringIO
>>> fp = StringIO('''a
... b
... xxx 1
... c
... xxx 2
... d
... e
... xxx 3
... f
... g
... h
... xxx 4
... i''')
>>> print ''.join(delete(fp, 'xxx'))
a
b
xxx 1
c
d
e
xxx 3
f
g
h
xxx 4
i
This "answer" is for lyrae ... I'll amend my previous comment: if the needle is in the first 3 lines of the file, your script will either cause an IndexError or access a line that it shouldn't be accessing, sometimes with interesting side-effects.
Example of your script causing IndexError:
>>> lines = "#string line 0\nblah blah\n".splitlines(True)
>>> needle = "#string "
>>> for i,line in enumerate(lines):
... if line.startswith(needle) and lines[i-3].startswith(needle):
... lines[i-3] = lines[i-3].replace(needle, "")
...
Traceback (most recent call last):
File "<stdin>", line 2, in <module>
IndexError: list index out of range
and this example shows not only that the Earth is round but also why your "fix" to the "don't delete the whole line" problem should have used .replace(needle, "", 1) or [len(needle):] instead of .replace(needle, "")
>>> lines = "NEEDLE x NEEDLE y\nnoddle\nnuddle\n".splitlines(True)
>>> needle = "NEEDLE"
>>> # Expected result: no change to the file
... for i,line in enumerate(lines):
... if line.startswith(needle) and lines[i-3].startswith(needle):
... lines[i-3] = lines[i-3].replace(needle, "")
...
>>> print ''.join(lines)
x y <<<=== whoops!
noddle
nuddle
<<<=== still got unwanted newline in here
>>>
My awk-fu has never been that good... but the following may provide you what you're looking for in a bash-shell/shell-utility form:
sed `awk 'BEGIN{ORS=";"}
/#STRING_A/ {
if(LAST!="" && LAST+3 >= NR) print LAST "d"
LAST = NR
}' test_file` test_file
Basically... awk is producing a command for sed to strip certain lines. I'm sure there's a relatively easy way to make awk do all of the processing, but this does seem to work.
The bad part? It does read the test_file twice.
The good part? It is a bash/shell-utility implementation.
Edit: Alex Martelli points out that the sample file above might have confused me. (my above code deletes the whole line, rather than the #STRING_A flag only)
This is easily remedied by adjusting the command to sed:
sed `awk 'BEGIN{ORS=";"}
/#STRING_A/ {
if(LAST!="" && LAST+3 >= NR) print LAST "s/#STRING_A//"
LAST = NR
}' test_file` test_file
This may be what you're looking for?
lines = open('sample.txt').readlines()
needle = "#string "
for i,line in enumerate(lines):
if line.startswith(needle) and lines[i-3].startswith(needle):
lines[i-3] = lines[i-3].replace(needle, "")
print ''.join(lines)
this outputs:
string 0 extra text
string 1 extra text
string 2 extra text
string 3 extra text
--replaced -- 4 extra text
string 5 extra text
string 6 extra text
#string 7 extra text
string 8 extra text
string 9 extra text
string 10 extra text
In bash you can use sort -r filename and tail -n filename to read the file backwards.
$LINES=`tail -n filename | sort -r`
# now iterate through the lines and do your checking
I would consider using sed. gnu sed supports definition of line ranges. if sed would fail, then there is another beast - awk and I'm sure you can do it with awk.
O.K. I feel I should put my awk POC. I could not figure out to use sed addresses. I have not tried combination of awk+sed, but it seems to me it's overkill.
my awk script works as follows:
It reads lines and stores them into 3 line buffer
once desired pattern is found (/^data.*/ in my case), the 3-line buffer is looked up to check, whether desired pattern has been seen three lines ago
if pattern has been seen, then 3 lines are scratched
to be honest, I would probably go with python also, given that awk is really awkward.
the AWK code follows:
function max(a, b)
{
if (a > b)
return a;
else
return b;
}
BEGIN {
w = 0; #write index
r = 0; #read index
buf[0, 1, 2]; #buffer
}
END {
# flush buffer
# start at read index and print out up to w index
for (k = r % 3; k r - max(r - 3, 0); k--) {
#search in 3 line history buf
if (match(buf[k % 3], /^data.*/) != 0) {
# found -> remove lines from history
# by rewriting them -> adjust write index
w -= max(r, 3);
}
}
buf[w % 3] = $0;
w++;
}
/^.*/ {
# store line into buffer, if the history
# is full, print out the oldest one.
if (w > 2) {
print buf[r % 3];
r++;
buf[w % 3] = $0;
}
else {
buf[w] = $0;
}
w++;
}