Develop Reference

iter through the dict store the key value and iter again to look for similar word in dict and delete form dict eg(Light1on,Light1off) in Python

[I had problem on how to iter through dict to find a pair of similar words and output it then the delete from dict]
My intention is to generate a random output label then store it into dictionary then iter through the dictionary and store the first key in the list or some sort then iter through the dictionary to search for similar key eg Light1on and Light1off has Light1 in it and get the value for both of the key to store into a table in its respective columns.
such as
Dict = {Light1on,Light2on,Light1off...}
store value equal to Light1on the iter through the dictionary to get eg Light1 off then store its Light1on:value1 and Light1off:value2 into a table or DF with columns name: On:value1 off:value2
As I dont know how to insert the code as code i can only provide the image sry for the trouble,its my first time asking question here thx.
from collections import defaultdict
import difflib, random
olist = []
input = 10
olist1 = ['Light1on','Light2on','Fan1on','Kettle1on','Heater1on']
olist2 = ['Light2off','Kettle1off','Light1off','Fan1off','Heater1off']
events = list(range(input + 1))
for i in range(len(olist1)):
output1 = random.choice(olist1)
print(output1,'1')
olist1.remove(output1)
output2 = random.choice(olist2)
print(output2,'2')
olist2.remove(output2)
olist.append(output1)
olist.append(output2)
print(olist,'3')
outputList = {olist[i]:events[i] for i in range(10)}
print (str(outputList),'4')
# Iterating through the keys finding a pair match
for s in range(5):
for i in outputList:
if i == list(outputList)[0]:
skeys = difflib.get_close_matches(i, outputList, n=2, cutoff=0.75)
print(skeys,'5')
del outputList[skeys]
# Modified Dictionary
difflib.get_close_matches('anlmal', ['car', 'animal', 'house', 'animaltion'])
['animal']
Updated: I was unable to delete the pair of similar from the list(Dictionary) after founding par in the dictionary

You're probably getting an error about a dictionary changing size during iteration. That's because you're deleting keys from a dictionary you're iterating over, and Python doesn't like that:
d = {1:2, 3:4}
for i in d:
del d[i]
That will throw:
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
RuntimeError: dictionary changed size during iteration
To work around that, one solution is to store a list of the keys you want to delete, then delete all those keys after you've finished iterating:
keys_to_delete = []
d = {1:2, 3:4}
for i in d:
if i%2 == 1:
keys_to_delete.append(i)
for i in keys_to_delete:
del d[i]
Ta-da! Same effect, but this way avoids the error.
Also, your code above doesn't call the difflib.get_close_matches function properly. You can use print(help(difflib.get_close_matches)) to see how you are meant to call that function. You need to provide a second argument that indicates the items to which you wish to compare your first argument for possible matches.
All of that said, I have a feeling that you can accomplish your fundamental goals much more simply. If you spend a few minutes describing what you're really trying to do (this shouldn't involve any references to data types, it should just involve a description of your data and your goals), then I bet someone on this site can help you solve that problem much more simply!

Testing if a dictionary key ends in a letter?

tools = {"Wooden_Sword1" : 10, "Bronze_Helmet1 : 20}
I have code written to add items, i'm adding an item like so:
tools[key_to_find] = int(b)
the key_to_find is the tool and the b is the durability and i need to find a way so if i'm adding and Wooden_Sword1 already exists it adds a Wooden_Sword2 instead. This has to work with other items as well

As user3483203 and ShadowRanger commented, it's probably a bad idea to use numbers in your key string as part of the data. Manipulating those numbers will be awkward, and there are better alternatives. For instance, rather than storing a single value for each numbered key, use simple keys and store a list. The index into the list will take the place of the number in the key.
Here's how you could implement it:
tools = {"Wooden_Sword" : [10], "Bronze_Helmet" : [20]}
Add a new wooden sword with durability 10:
tools.setdefault("Wooden_Sword", []).append(10)
Find how many bronze helmets we have:
helmets = tools.get("Bronze_Helmet", [])
print("we have {} helmets".format(len(helmets)))
Find the first bronze helmet with a non-zero durability, and reduce it by 1:
helmets = tools.get("Bronze_Helmet", [])
for i, durability in helmets:
if durability > 0:
helmets[i] -= 1
break
else: # this runs if the break statement was never reached and the loop ran to completion
take_extra_damage() # or whatever
You could simplify some of this code by using a collections.defaultdict instead of a regular dictionary, but if you learn how to use get and setdefault it's not too hard to get by with the regular dict.

To ensure a key name is not taken yet, and add a number if it is, create the new name and test. Then increment the number if it is already in your list. Just repeat until none is found.
In code:
def next_name(basename, lookup):
if basename not in lookup:
return basename
number = 1
while basename+str(number) in lookup:
number += 1
return basename+str(number)
While this code does what you ask, you may want to look at other methods. A possible drawback is that there is no association between, say, WoodenShoe1 and WoodenShoe55 – if 'all wooden shoes' need their price increased, you'd have to iterate over all possible names between 1 and 55, just in case these existed at some time.

From what I understand of the question, your keys have 2 parts: "Name" and "ID". The ID is just an integer that starts at 1, so you can initialize a counter for every name:
numOfWoodenSwords = 0
And to add to the array:
numOfWoodenSwords += 1
tools["wodden_sword" + str(numOfWoodenSwords)] = int(b)
If you need to have an unknown amount of tools, I recommend looking at the re module: https://docs.python.org/3/library/re.html.
Or you could iterate over tools.keys to see if the entry exists.

You could write a function that determines if a character is a letter:
def is_letter(char):
return 65 <= ord(char) <= 90 or 97 <= ord(char) <= 122
Then when you are looking at a key in your dictionary, simply:
if is_letter(key[-1]):
...

Python: My directory is not giving individual value output

I have created a code that imports data via .xlrd in two directories in Python.
Code:
import xlrd
#category.clear()
#term.clear()
book = xlrd.open_workbook("C:\Users\Koen\Google Drive\etc...etc..")
sheet = book.sheet_by_index(0)
num_rows = sheet.nrows
for i in range(1,num_rows,1):
category = {i:( sheet.cell_value(i, 0))}
term = {i:( sheet.cell_value(i, 1))}
When I open one of the two directories (category or term), it will present me with a list of values.
print(category[i])
So far, so good.
However, when I try to open an individual value
print(category["2"])
, it will consistently give me an error>>
Traceback (most recent call last):
File "testfile", line 15, in <module>
print(category["2"])
KeyError: '2'
The key's are indeed numbered (as determined by i).
I've already tried to []{}""'', etc etc. Nothing works.
As I need those values later on in the code, I would like to know what the cause of the key-error is.
Thanks in advance for taking a look!

First off, you are reassigning category and term in every iteration of the for loop, this way the dictionary will always have one key at each iteration, finishing with the last index, so if our sheet have 100 lines, the dict will only have the key 99. To overcome this, you need to define the dictionary outside the loop and assign the keys inside the loop, like following:
category = {}
term = {}
for i in range(1, num_rows, 1):
category[i] = (sheet.cell_value(i, 0))
term[i] = (sheet.cell_value(i, 1))
And second, the way you are defining the keys using the for i in range(1, num_rows, 1):, they are integers, so you have to access the dictionary keys like so category[1]. To use string keys you need to cast them with category[str(i)] for example.
I hope have clarifying the problem.

Constantly getting IndexError and am unsure why in Python

I am new to python and really programming in general and am learning python through a website called rosalind.info, which is a website that aims to teach through problem solving.
Here is the problem, wherein you're asked to calculate the percentage of guanine and thymine to the string of DNA given to for each ID, then return the ID of the sample with the greatest percentage.
I'm working on the sample problem on the page and am experiencing some difficulty. I know my code is probably really inefficient and cumbersome but I take it that's to be expected for those who are new to programming.
Anyway, here is my code.
gc = open("rosalind_gcsamp.txt","r")
biz = gc.readlines()
i = 0
gcc = 0
d = {}
for i in xrange(biz.__len__()):
if biz[i].startswith(">"):
biz[i] = biz[i].replace("\n","")
biz[i+1] = biz[i+1].replace("\n","") + biz[i+2].replace("\n","")
del biz[i+2]
What I'm trying to accomplish here is, given input such as this:
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
Break what's given into a list based on the lines and concatenate the two lines of DNA like so:
['>Rosalind_6404', 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG', 'TCCCACTAATAATTCTGAGG\n']
And delete the entry two indices after the ID, which is >Rosalind. What I do with it later I still need to figure out.
However, I keep getting an index error and can't, for the life of me, figure out why. I'm sure it's a trivial reason, I just need some help.
I've even attempted the following to limited success:
for i in xrange(biz.__len__()):
if biz[i].startswith(">"):
biz[i] = biz[i].replace("\n","")
biz[i+1] = biz[i+1].replace("\n","") + biz[i+2].replace("\n","")
elif biz[i].startswith("A" or "C" or "G" or "T") and biz[i+1].startswith(">"):
del biz[i]
which still gives me an index error but at least gives me the biz value I want.
Thanks in advance.

It is very easy do with itertools.groupby using lines that start with > as the keys and as the delimiters:
from itertools import groupby
with open("rosalind_gcsamp.txt","r") as gc:
# group elements using lines that start with ">" as the delimiter
groups = groupby(gc, key=lambda x: not x.startswith(">"))
d = {}
for k,v in groups:
# if k is False we a non match to our not x.startswith(">")
# so use the value v as the key and call next on the grouper object
# to get the next value
if not k:
key, val = list(v)[0].rstrip(), "".join(map(str.rstrip,next(groups)[1],""))
d[key] = val
print(d)
{'>Rosalind_0808': 'CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT', '>Rosalind_5959': 'CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCTATATCCATTTGTCAGCAGACACGC', '>Rosalind_6404': 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG'}
If you need order use a collections.OrderedDict in place of d.

You are looping over the length of biz. So in your last iteration biz[i+1] and biz[i+2] don't exist. There is no item after the last.

Ways of comparing Dictionaries

I have a dictionary:
vd = {'Klein': [1,1,1], 'Fox-Epstein': [1,-1,0], 'Ravella': [-1,0,0]}
I need a procedure that iterates over the dictionary checking which entry is most similar to one provided as an argument. I have two procedures the first is nested in the second.
def policy_compare(sen_a, sen_b, voting_dict):
a = 0
for i in range(len(voting_dict[sen_a])):
a += voting_dict[sen_a][i] * voting_dict[sen_b][i]
return a
This returns the dot product of two of the selected entries.
def most_similar(sen, voting_dict):
a = []
for i in voting_dict.keys():
score = policy_compare(sen,i, voting_dict)
a += score
return a
The second procedure is not complete for two reasons:
At the moment it is returning an error and I can't see where I am going wrong.
It just returns a list of the dot products (The one with the greatest dot product in the most similar), whereas I require the 'key' who's scalar product with the chosen sen is largest.
FULL error.
Traceback (most recent call last):
File "<pyshell#17>", line 1, in <module>
most_similar('Klein', vd)
File "/Users/anthony/Desktop/matrix/megalol.py", line 15, in most_similar
a += score
TypeError: 'int' object is not iterable

a is a list, score is an int. You can't add the two together. A list is iterated over in order to get the contents in order to add them to another - thus the "weird" error. It can't iterate over the int (score) in order to add it to the the list (a).
try a.append(score) to add score on to the end of it.

Here are some modifications to approach the solution you want:
vd = {'Klein': [1,1,1], 'Fox-Epstein': [1,-1,0], 'Ravella': [-1,0,0]}
def policy_compare(sen_a, sen_b, voting_dict):
a = 0
for i in range(len(voting_dict[sen_a])):
a += voting_dict[sen_a][i] * voting_dict[sen_b][i]
return a
def most_similar(sen, voting_dict):
a = []
for this_sen in voting_dict.keys():
if this_sen == sen:
continue
score = policy_compare(sen, this_sen, voting_dict)
a.append((this_sen, score))
return max(a,key=lambda sen: sen[1])
print most_similar('Klein', vd)
As someone else has said, you want to append to your list a. I've added the senator's name along with the dot product in a tuple (for each item in a) because the dictionary keys come out in arbitrary order and you won't know which one is being referred to by each entry in a otherwise. I've returned the maximum dot product entry from most_similar. Also, to avoid comparing senators with themselves you want to use continue (go back to the start of the loop for the next iteration), not pass (do nothing and continue with the current iteration).