Python Finding Index of Foreign Characters - python

I have a simple script that prints index of given character in a string. However when the string includes letters which are not English , I got error.
def toBinary(character):
binaryTable = "ABCDEFGHIJKLMNOPQRSTUVWXYZÇÜŞĞİ"
return binaryTable.index(character)+1
But when use the binaryTable array , in a function , for example I permutate it using my own method
def permutation(text_block,permutation_array,reverse):
print permutation_array
temp = [None]*len(text_block)
temp_P = []
for i in permutation_array:
temp_P.append(i)
i = 0
if reverse:
#permutation_array.reverse()
temp_P.reverse()
for integer in temp_P:
temp [i] = text_block[integer]
i += 1
return temp,temp_P
the array includes ascii characters like "\xc4" , "\xb0" .So when I run my binary converter method after permutation method it calls like
toBinary("\xc4")
Therefore I get "TypeError: expected a string or other character buffer object" error in toBinary method.
How can I get rid of it?

Related

String counts python with a function and input

I have this task:
Create a program that counts and displays in the terminal the number of characters of the following words. The program must contain at least one function.
This is what i created:
value = input("Write your word here:")
def word(value):
word = 0
for i in len(int(value)):
print(value)
How i solve the task?
your code has to be edited. As you are beginner I added some explanation for you.
As you are beginner you can check some Python-tutorial to learn Python.
# write your function, which will iterate over the value
# and print each character
def word(value):
for i in range(len(value)): # range, instead of len(value), int values are not iterable
print(value[i]) # print the i-th value
# you can directly iterate on value which is a string
for c in value:
print(c)
value = input("Write your word here:")
word(value)

Display list sorted alphabetically

We're trying to create a function that takes the input, some data containing the following information: ID number, Name, as well as a number of columns containing the grades for different assignments, and then sorts the data alphabetically (according to the name) and then displays the data with a column added that also displays the final grade (that we calculate with another function we made). We've tried writing the following code, but can't get it to work... The error-message given is "names = GRADESdata[:,1].tolist() TypeError: string indices must be integers".
Can anyone help us to figure out how to get it working?
def listOfgrades(GRADESdata):
names = GRADESdata[:,1].tolist()
names = names.sort(names)
assignments = GRADESdata[:,2::]
final_grades = computeFinalGrades(GRADESdata)
final_grades = np.array(final_grades.reshape(len(final_grades),1))
List_of_grades = np.hstack((GRADESdata, final_grades))
NOofColumns = np.size(GRADESdata,axis = 1)
display = np.zeros(NOofColumns)
for i in names:
display = np.vstack((display,GRADESdata[GRADESdata[:,1] == i]))
grades = display[1::,2:-1]
gradesfinal = display[1::,-1]
#Column titles
c = {"Student ID": GRADESdata[1::,0], "Name": GRADESdata[1::,1]}
for i in range(GRADESdata.shape[1]):
c["Assign.{}".format(i+1)] = GRADESdata[:,i]
c["Final grade"] = final_grades
d = pd.DataFrame(c)
print(d.to_string())
display = np.array([student_list, names, assignments, final_grades])
return display
The expected output is something like this (with the data below ofc):
ID number Name Assignment 1 Assignment 2 Final Grade
EDIT: the data input is a .csv file containing the following data:ID number,Name,Assignment 1,Assignment 2, etc.
The comma in
names = GRADESdata[:,1].tolist()
is not a valid character. the part between [: and ] must be an integer
From looking at .tolist(), I assume the data structure you're supposed to use is numpy.ndarray.
I managed to replicate the error with the following code:
print("12354"[:,1].tolist())
which makes sense if you're using a file name as input - and that's your mistake.
In order to fix this problem, you need to implement a string parser at the beginning or outside the function.
Add the following to your code at the beginning:
file=open(GRADESdata,"r")
data=file.read()
file.close()
list1=data.split("\n")#Replace \n with appropriate line separator
list2=[e.split(",") for e in list1]
GRADESdata=numpy.array(list2)

Iterating a conversion of a string to a float in a scripting file when parsing an old file

I am using a new script (a) to extract information from an old script (b) to create a new file (c). I am looking for an equal sign in the old script (b) and want to modify the modification script (a) to make it automated.
The string is
lev1tolev2 'from=e119-b3331l1 mappars="simp:180" targ=enceladus.bi.def.3 km=0.6 lat=(-71.5,90) lon=(220,360)'
It is written in python 3.
The current output is fixed at
cam2map from=e119-b3331l1 to=rsmap-x map=enc.Ink.map pixres=mpp defaultrange=MAP res=300 minlat=-71.5 maxlat=90 minlon=220 maxlon=360
Currently, I have the code able to export a string of 0.6 for all of the iterations of lev1tolev2, but each one of these is going to be different.
cam2map = Call("cam2map")
cam2map.kwargs["from"] = old_lev1tolev2.kwargs["from"]
cam2map.kwargs["to"] = "rsmap-x"
cam2map.kwargs["map"] = "enc.Ink.map"
cam2map.kwargs["pixres"] = "mpp"
cam2map.kwargs["defaultrange"] = "MAP"
**cam2map.kwargs["res"] = float((old_lev1tolev2.kwargs["km"]))**
cam2map.kwargs["minlat"] = lat[0]
cam2map.kwargs["maxlat"] = lat[1]
cam2map.kwargs["minlon"] = lon[0]
cam2map.kwargs["maxlon"] = lon[1]
I have two questions, why is this not converting the string to a float? And, why is this not iterating over all of the lev1tolev2 commands as everything else in the code does?
The full code is available here.
https://codeshare.io/G6drmk
The problem occurred at a different location in the code.
def escape_kw_value(value):
if not isinstance(value, str):
return value
elif (value.startswith(('"', "'")) and value.endswith(('"', "'"))):
return value
# TODO escape the quote with \" or \'
#if value.startswith(('"', "'")) or value.endswith(('"', "'")):
# return value
if " " in value:
value = '"{}"'.format(value)
return value
it doesn't seem to clear to me, but from you syntax here :
**cam2map.kwargs["res"] = float((old_lev1tolev2.kwargs["km"]))**
I'd bet that cam2map.kwargs["res"] is a dict, and you thought that it would convert every values in the dict, using the ** syntax. The float built-in should then be called in a loop over the elements of the dict, or possible a list-comprehension as here :
cam2map.kwargs["res"] = dict()
for key, value in old_lev1tolev2.kwars["res"].items():
cam2map.kwargs["res"][key] = float(value)
Edit :
Ok so, it seems you took the string 'from=e119-b3331l1 mappars="simp:180" targ=enceladus.bi.def.3 km=0.6 lat=(-71.5,90) lon=(220,360)'
And then thought that calling youstring.kwargs would give you a dict, but it won't, you can probably parse it to a dict first, using some lib, or, you use mystring.split('=') and then work your way to a dict first, like that:
output = dict()
for one_bit in lev_1_lev2.split(' '):
key, value = one_bit.split('=')
output[key] = value

This code keeps giving me: string indices must be integers

I keep getting a TypeError: string indices must be integers. Not sure how to correct this.
def get_next_target(string):
start_str=string.find('<')
if start_str==-1:
return None,0
end_str=string.find('>',start_str)
next_start_str=string.find('<',end_str)
if next_start_str==-1:
return string[end_str+1:]
word=string[end_str+1,next_start_str]
return word,next_start_str
print (get_next_target('<h1>Title <>'))
You are trying to use a , for string slicing, which is causing this to become a tuple. You need to replace the , with a :
word=string[end_str + 1:next_start_str]

eliminate '\n' in dictionary

I have a dictionary looks like this, the DNA is the keys and quality value is value:
{'TTTGTTCTTTTTGTAATGGGGCCAGATGTCACTCATTCCACATGTAGTATCCAGATTGAAATGAAATGAGGTAGAACTGACCCAGGCTGGACAAGGAAGG\n':
'eeeecdddddaaa`]eceeeddY\\cQ]V[F\\\\TZT_b^[^]Z_Z]ac_ccd^\\dcbc\\TaYcbTTZSb]Y]X_bZ\\a^^\\S[T\\aaacccBBBBBBBBBB\n',
'ACTTATATTATGTTGACACTCAAAAATTTCAGAATTTGGAGTATTTTGAATTTCAGATTTTCTGATTAGGGATGTACCTGTACTTTTTTTTTTTTTTTTT\n':
'dddddd\\cdddcdddcYdddd`d`dcd^dccdT`cddddddd^dddddddddd^ddadddadcd\\cda`Y`Y`b`````adcddd`ddd_dddadW`db_\n',
'CTGCCAGCACGCTGTCACCTCTCAATAACAGTGAGTGTAATGGCCATACTCTTGATTTGGTTTTTGCCTTATGAATCAGTGGCTAAAAATATTATTTAAT\n':
'deeee`bbcddddad\\bbbbeee\\ecYZcc^dd^ddd\\\\`]``L`ccabaVJ`MZ^aaYMbbb__PYWY]RWNUUab`Y`BBBBBBBBBBBBBBBBBBBB\n'}
I want to write a function so that if I query a DNA sequence, it returns a tuple of this DNA sequence and its corresponding quality value
I wrote the following function, but it gives me an error message that says list indices must be integers, not str
def query_sequence_id(self, dna_seq=''):
"""Overrides the query_sequence_id so that it optionally returns both the sequence and the quality values.
If DNA sequence does not exist in the class, return a string error message"""
list_dna = []
for t in self.__fastqdict.keys():
list_dna.append(t.rstrip('\n'))
self.dna_seq = dna_seq
if self.dna_seq in list_dna:
return (self.dna_seq,self.__fastqdict.values()[self.dna_seq + "\n"])
else:
return "This DNA sequence does not exist"
so I want something like if I print
query_sequence_id("TTTGTTCTTTTTGTAATGGGGCCAGATGTCACTCATTCCACATGTAGTATCCAGATTGAAATGAAATGAGGTAGAACTGACCCAGGCTGGACAAGGAAGG"),
I would get
('TTTGTTCTTTTTGTAATGGGGCCAGATGTCACTCATTCCACATGTAGTATCCAGATTGAAATGAAATGAGGTAGAACTGACCCAGGCTGGACAAGGAAGG',
'eeeecdddddaaa`]eceeeddY\\cQ]V[F\\\\TZT_b^[^]Z_Z]ac_ccd^\\dcbc\\TaYcbTTZSb]Y]X_bZ\\a^^\\S[T\\aaacccBBBBBBBBBB')
I want to get rid of "\n" for both keys and values, but my code failed. Can anyone help me fix my code?
The newline characters aren't your problem, though they are messy. You're trying to index the view returned by dict.values() based on the string. That's not only not what you want, but it also defeats the whole purpose of using the dictionary in the first place. Views are iterables, not mappings like dicts are. Just look up the value in the dictionary, the normal way:
return (self.dna_seq, self.__fastqdict[self.dna_seq + "\n"])
As for the newlines, why not just take them out when you build the dictionary in the first place?
To modify the dictionary you can just do the following:
myNewDict = {}
for var in myDict:
myNewDict[var.strip()] = myDict[var].strip()
You can remove those pesky newlines from your dictionary's keys and values like this (assuming your dictionary was stored in a variable nameddna):
dna = {k.rstrip(): v.rstrip() for k, v in dna.iteritems()}

Categories

Resources