I am designing a program that will encode. messages imported from a csv. It will do this by converting them their ASCII value, adding 2 to them and then converting them back to characters.
My current problem is that while my code will encode each character in each string the messages are now no longer joined together.
Any help would be appreciated.
My code:
#importing csv file and allowing it to be read from
import csv
ifile = open("messages.csv","rb")
reader= csv.reader(ifile)
#creating lists
plain_text=[]
plain_ascii=[]
encrypted_ascii=[]
encrypted_text=[]
latitude=[]
longitude=[]
#appending csv data to separate lists
for row in reader:
latitude.append(row[0])
longitude.append(row[1])
plain_text.append(row[2])
#encoding messages
encrypted_text=[[chr(ord(ch)+2) for ch in string] for string in plain_text]
print plain_text
print encrypted_text
ifile.close()
The current output:
['A famous Scottish victory in the First War of Scottish Independence - bit.ly/1yIAb8Q', "How high is Scotland's tallest mountain? - bit.ly/1q3Rj6D", 'What is the traditional instrument most often linked with Scotland? - http://#bit.ly/1lNdrk3', "A prickly problem Scotland's national symbol - bit.ly/1q3REpQ", 'Name the largest city in Scotland - bit.ly/T4OEuU']
[['C', '"', 'h', 'c', 'o', 'q', 'w', 'u', '"', 'U', 'e', 'q', 'v', 'v', 'k', 'u', 'j', '"', 'x', 'k', 'e', 'v', 'q', 't', '{', '"', 'k', 'p', '"', 'v', 'j', 'g', '"', 'H', 'k', 't', 'u', 'v', '"', 'Y', 'c', 't', '"', 'q', 'h', '"', 'U', 'e', 'q', 'v', 'v', 'k', 'u', 'j', '"', 'K', 'p', 'f', 'g', 'r', 'g', 'p', 'f', 'g', 'p', 'e', 'g', '"', '/', '"', 'd', 'k', 'v', '0', 'n', '{', '1', '3', '{', 'K', 'C', 'd', ':', 'S'], ['J', 'q', 'y', '"', 'j', 'k', 'i', 'j', '"', 'k', 'u', '"', 'U', 'e', 'q', 'v', 'n', 'c', 'p', 'f', ')', 'u', '"', 'v', 'c', 'n', 'n', 'g', 'u', 'v', '"', 'o', 'q', 'w', 'p', 'v', 'c', 'k', 'p', 'A', '"', '/', '"', 'd', 'k', 'v', '0', 'n', '{', '1', '3', 's', '5', 'T', 'l', '8', 'F'], ['Y', 'j', 'c', 'v', '"', 'k', 'u', '"', 'v', 'j', 'g', '"', 'v', 't', 'c', 'f', 'k', 'v', 'k', 'q', 'p', 'c', 'n', '"', 'k', 'p', 'u', 'v', 't', 'w', 'o', 'g', 'p', 'v', '"', 'o', 'q', 'u', 'v', '"', 'q', 'h', 'v', 'g', 'p', '"', 'n', 'k', 'p', 'm', 'g', 'f', '"', 'y', 'k', 'v', 'j', '"', 'U', 'e', 'q', 'v', 'n', 'c', 'p', 'f', 'A', '"', '/', '"', 'j', 'v', 'v', 'r', '<', '1', '1', 'd', 'k', 'v', '0', 'n', '{', '1', '3', 'n', 'P', 'f', 't', 'm', '5'], ['C', '"', 'r', 't', 'k', 'e', 'm', 'n', '{', '"', 'r', 't', 'q', 'd', 'n', 'g', 'o', '"', 'U', 'e', 'q', 'v', 'n', 'c', 'p', 'f', ')', 'u', '"', 'p', 'c', 'v', 'k', 'q', 'p', 'c', 'n', '"', 'u', '{', 'o', 'd', 'q', 'n', '"', '/', '"', 'd', 'k', 'v', '0', 'n', '{', '1', '3', 's', '5', 'T', 'G', 'r', 'S'], ['P', 'c', 'o', 'g', '"', 'v', 'j', 'g', '"', 'n', 'c', 't', 'i', 'g', 'u', 'v', '"', 'e', 'k', 'v', '{', '"', 'k', 'p', '"', 'U', 'e', 'q', 'v', 'n', 'c', 'p', 'f', '"', '/', '"', 'd', 'k', 'v', '0', 'n', '{', '1', 'V', '6', 'Q', 'G', 'w', 'W']]
You need to join the inner lists.
[''.join(chr(ord(ch)+2) for ch in string) for string in plain]
Related
I have an array consisting of labels but each label has been broken down by individual characters. For example, this is the first 2 elements of the array:
array([['1', '.', ' ', 'I', 'd', 'e', 'n', 't', 'i', 'f', 'y', 'i', 'n',
'g', ',', ' ', 'A', 's', 's', 'e', 's', 's', 'i', 'n', 'g', ' ',
'a', 'n', 'd', ' ', 'I', 'm', 'p', 'r', 'o', 'v', 'i', 'n', 'g',
' ', 'C', 'a', 'r', 'e', '', ''],
['9', '.', ' ', 'N', 'o', 'n', '-', 'P', 'h', 'a', 'r', 'm', 'a',
'c', 'o', 'l', 'o', 'g', 'i', 'c', 'a', 'l', ' ', 'I', 'n', 't',
'e', 'r', 'v', 'e', 'n', 't', 'i', 'o', 'n', 's', '', '', '',
'', ''], ...
I would like it to be formatted as such:
array(['1. Identifying, Assessing and Improving Care',
'9. Non-Pharmacological Interventions', ...
I want to be able to iterate through a concatenate the label output so it is as shown above.
Any help in achieving this would be much appreciated :) Many thanks!
import numpy as np
k=np.array([['1', '.', ' ', 'I', 'd', 'e', 'n', 't', 'i', 'f', 'y', 'i', 'n',
'g', ',', ' ', 'A', 's', 's', 'e', 's', 's', 'i', 'n', 'g', ' ',
'a', 'n', 'd', ' ', 'I', 'm', 'p', 'r', 'o', 'v', 'i', 'n', 'g',
' ', 'C', 'a', 'r', 'e', '', ''],
['9', '.', ' ', 'N', 'o', 'n', '-', 'P', 'h', 'a', 'r', 'm', 'a',
'c', 'o', 'l', 'o', 'g', 'i', 'c', 'a', 'l', ' ', 'I', 'n', 't',
'e', 'r', 'v', 'e', 'n', 't', 'i', 'o', 'n', 's', '', '', '',
'', '']])
for x in k:
print(''.join(x))
#output
1. Identifying, Assessing and Improving Care
9. Non-Pharmacological Interventions
Using List comprehension:
[''.join(x) for x in k]
#output
['1. Identifying, Assessing and Improving Care',
'9. Non-Pharmacological Interventions']
Considering the array as a list of lists, you could join all characters by looping through the list:
r = [['1', '.', ' ', 'I', 'd', 'e', 'n', 't', 'i', 'f', 'y', 'i', 'n',
'g', ',', ' ', 'A', 's', 's', 'e', 's', 's', 'i', 'n', 'g', ' ',
'a', 'n', 'd', ' ', 'I', 'm', 'p', 'r', 'o', 'v', 'i', 'n', 'g',
' ', 'C', 'a', 'r', 'e', '', ''],
['9', '.', ' ', 'N', 'o', 'n', '-', 'P', 'h', 'a', 'r', 'm', 'a',
'c', 'o', 'l', 'o', 'g', 'i', 'c', 'a', 'l', ' ', 'I', 'n', 't',
'e', 'r', 'v', 'e', 'n', 't', 'i', 'o', 'n', 's', '', '', '',
'', '']]
t = ["".join(i) for i in r]
print(t)
Output:
['1. Identifying, Assessing and Improving Care',
'9. Non-Pharmacological Interventions']
array = [['1', '.', ' ', 'I', 'd', 'e', 'n', 't', 'i', 'f', 'y', 'i', 'n',
'g', ',', ' ', 'A', 's', 's', 'e', 's', 's', 'i', 'n', 'g', ' ',
'a', 'n', 'd', ' ', 'I', 'm', 'p', 'r', 'o', 'v', 'i', 'n', 'g',
' ', 'C', 'a', 'r', 'e', '', ''],
['9', '.', ' ', 'N', 'o', 'n', '-', 'P', 'h', 'a', 'r', 'm', 'a',
'c', 'o', 'l', 'o', 'g', 'i', 'c', 'a', 'l', ' ', 'I', 'n', 't',
'e', 'r', 'v', 'e', 'n', 't', 'i', 'o', 'n', 's', '', '', '',
'', '']]
# array(['1. Identifying, Assessing and Improving Care',
# '9. Non-Pharmacological Interventions', ...
array = [''.join(i) for i in array]
print(array) #['1. Identifying, Assessing and Improving Care', '9. Non-Pharmacological Interventions']
Assuming from array([...]) that you are using numpy, here's a solution
import numpy as np
a = np.array([['1', '.', ' ', 'I', 'd', 'e', 'n', 't', 'i', 'f', 'y', 'i', 'n',
'g', ',', ' ', 'A', 's', 's', 'e', 's', 's', 'i', 'n', 'g', ' ',
'a', 'n', 'd', ' ', 'I', 'm', 'p', 'r', 'o', 'v', 'i', 'n', 'g',
' ', 'C', 'a', 'r', 'e', '', ''],
['9', '.', ' ', 'N', 'o', 'n', '-', 'P', 'h', 'a', 'r', 'm', 'a',
'c', 'o', 'l', 'o', 'g', 'i', 'c', 'a', 'l', ' ', 'I', 'n', 't',
'e', 'r', 'v', 'e', 'n', 't', 'i', 'o', 'n', 's', '', '', '',
'', '']])
b = np.empty(a.shape[0], dtype=object)
for i, x in enumerate(a): b[i] = ''.join(x)
If you make a loop over each element of your array, you can then use list .join to get what you are looking for.
Something like:
arr = [['1', '.', ' ', 'I', ...], ...]
output = list()
for x in arr:
output.append(''.join(x))
output
>>>
['1. Identifying, Assessing and Improving Care', ...]
Is there a "base64.b85decode" function in nodejs?
It uses the following character set -
0123456789
ABCDEFGHIJKLMNOPQRSTUVWXYZ
abcdefghijklmnopqrstuvwxyz
!#$%&()*+-;<=>?#^_`{|}~
It's not a regular Ascii85 encoding but a different base85 encoding type.
For example, for "Hello, world!!!!", It should return "NM&qnZ!92pZpv8At50l"
I solved it by using the ascii85 package and using a customized character set -
var ascii85 = require('ascii85');
ascii85.decode(to_decode, ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z', '!', '#', '$', '%', '&', '(', ')', '*', '+', '-', ';', '<', '=', '>', '?', '#', '^', '_', '`', '{', '|', '}', '~']).toString('ascii');
So I'm trying to add a new list to a 2d array inside a for loop, by taking the last letter of the list and putting it to the start, and adding this new list to the 2d array.
But although the new lists work, when I append to the 2d array, it just appends the normal alphabet, not my new one.
Can anybody see what I'm doing wrong?
def tabulaRecta():
import string
alpha = list(string.ascii_uppercase)
l2d = []
l2d.append(alpha)
for i in range(26):
temp = alpha[len(alpha)-1]
alpha.pop()
alpha.insert(0,temp)
l2d.append(alpha)
print(l2d)
tabulaRecta()
The program is supposed to output something like this, but all of these within a list:
['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z']
['Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y']
['Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X']
['X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W']
['W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V']
['V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U']
['U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T']
['T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S']
['S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R']
['R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q']
['Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P']
['P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O']
['O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N']
['N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M']
['M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L']
['L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K']
['K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J']
['J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I']
['I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H']
['H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G']
['G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F']
['F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E']
['E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C', 'D']
['D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B', 'C']
['C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A', 'B']
['B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z', 'A']
['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z']
instead it prints this 26 times in a list:
['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z']
Instead of saying print(...) you can append it to a list and print it when the loop is finished
s = list(string.ascii_uppercase)
>>> for i in range(len(s),-1,-1):
... print(s[i:]+s[:i])
['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z']
['Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y']
['Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X']
['X', 'Y', 'Z', 'A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W']
.
.
.
.
A 2d array is an array of pointers to arrays, and in your code each one points to the same list, that you are modifying 26 times eventually coming back to the original one.
You have to make a copy of the list each time you modify it.
For example, add a alpha = list(alpha) at the beginning of the for loop:
def tabulaRecta():
import string
alpha = list(string.ascii_uppercase)
l2d = []
l2d.append(alpha)
for i in range(26):
alpha = list(alpha)
temp = alpha[len(alpha) - 1]
alpha.pop()
alpha.insert(0, temp)
l2d.append(alpha)
print(l2d)
tabulaRecta()
You could also just do this:
import string
def tabula_rect():
alpha = list(string.ascii_uppercase)
l2d = []
l2d.append(alpha)
for i in range(len(alpha)):
temp = alpha[len(alpha)-1]
alpha = alpha[:-1]
alpha.insert(0, temp)
l2d.append(alpha)
return l2d
RNA_codon_dictonary = {
'UUU': 'F', 'CUU': 'L', 'AUU': 'I', 'GUU': 'V',
'UUC': 'F', 'CUC': 'L', 'AUC': 'I', 'GUC': 'V',
'UUA': 'L', 'CUA': 'L', 'AUA': 'I', 'GUA': 'V',
'UUG': 'L', 'CUG': 'L', 'AUG': 'M', 'GUG': 'V',
'UCU': 'S', 'CCU': 'P', 'ACU': 'T', 'GCU': 'A',
'UCC': 'S', 'CCC': 'P', 'ACC': 'T', 'GCC': 'A',
'UCA': 'S', 'CCA': 'P', 'ACA': 'T', 'GCA': 'A',
'UCG': 'S', 'CCG': 'P', 'ACG': 'T', 'GCG': 'A',
'UAU': 'Y', 'CAU': 'H', 'AAU': 'N', 'GAU': 'D',
'UAC': 'Y', 'CAC': 'H', 'AAC': 'N', 'GAC': 'D',
'UAA': 'Stop', 'CAA': 'Q', 'AAA': 'K', 'GAA': 'E',
'UAG': 'Stop', 'CAG': 'Q', 'AAG': 'K', 'GAG': 'E',
'UGU': 'C', 'CGU': 'R', 'AGU': 'S', 'GGU': 'G',
'UGC': 'C', 'CGC': 'R', 'AGC': 'S', 'GGC': 'G',
'UGA': 'Stop', 'CGA': 'R', 'AGA': 'R', 'GGA': 'G',
'UGG': 'W', 'CGG': 'R', 'AGG': 'R', 'GGG': 'G'
}
def RNA_to_Protien(mRNA_seq):
codon = []
if codon in RNA_codon_dictonary:
# return the aminoacid by looking up in the dictionary:
return RNA_codon_dictonary[codon]
else:
# return '' if we could not translate the codon:
return '?'
if __name__ == "__main__":
mRNA_seq = "UCAAUGUAACGCGCUACCCGGAGCUCUGGGCCCAAAUUUCAUCCACU"
print (RNA_to_Protien(mRNA_seq))
You are checking to see if the empty list is a key in your dictionary. There are two problems with that:
1) The answer will always be no, since your dictionary doesn't have any empty keys, and
2) That operation isn't even allowed, since lists are never allowed to be keys of a dict.
Based on your comment, the following code might be what you are looking for. It breaks the sequence in non-overlapping substrings of length 3, looks up each substring in the dict, and returns all of the results.
def RNA_to_Protien(mRNA_seq):
return [
RNA_codon_dictonary.get(mRNA_seq[i:i+3], '?')
for i in range(0, len(mRNA_seq), 3)
]
In your example sequence, this returns:
['S', 'M', 'Stop', 'R', 'A', 'T', 'R', 'S', 'S', 'G', 'P', 'K', 'F', 'H', 'P', '?']
Or, if you would rather lookup overlapping sequences, try this:
def RNA_to_Protien(mRNA_seq):
return [
RNA_codon_dictonary.get(mRNA_seq[i:i+3], '?')
for i in range(0, len(mRNA_seq)-2, 1)
]
It yields this result:
['S', 'Q', 'N', 'M', 'C', 'V', 'Stop', 'N', 'T', 'R', 'A', 'R', 'A', 'L', 'Y', 'T', 'P', 'P', 'R', 'G', 'E', 'S', 'A', 'L', 'S', 'L', 'W', 'G', 'G', 'A', 'P', 'P', 'Q', 'K', 'N', 'I', 'F', 'F', 'S', 'H', 'I', 'S', 'P', 'H', 'T']
And, based on your request to return a single string instead of a list of strings:
def RNA_to_Protien(mRNA_seq):
return ''.join(
RNA_codon_dictonary.get(mRNA_seq[i:i+3], '?')
for i in range(0, len(mRNA_seq), 3)
)
This yields:
'SMStopRATRSSGPKFHP?'
This question already has answers here:
How do I split a list into equally-sized chunks?
(66 answers)
Closed 8 years ago.
My list is ,
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
want to print every n elements of this list. Means in each iteration want to print N*elements from that list.
I tried ,
If N is 15.
>>> a=list(string.ascii_lowercase)
>>> for i in range(len(a)-1):
print a[i:i+15]
It prints
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o']
['b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p']
['c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q']
['d', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r']
['e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's']
['f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't']
['g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u']
['h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v']
['i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w']
['j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x']
['k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y']
['l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
['m', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
['n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
['o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
['p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
['q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
['r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
['s', 't', 'u', 'v', 'w', 'x', 'y', 'z']
['t', 'u', 'v', 'w', 'x', 'y', 'z']
['u', 'v', 'w', 'x', 'y', 'z']
['v', 'w', 'x', 'y', 'z']
['w', 'x', 'y', 'z']
['x', 'y', 'z']
['y', 'z']
What I want is ,
if N=15
['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o']
['p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z']
If N=5 ,
['a', 'b', 'c', 'd', 'e']
['f', 'g', 'h', 'i', 'j']
['k', 'l', 'm', 'n', 'o']
['p', 'q', 'r', 's', 't']
['u', 'v', 'w', 'x', 'y']
['z']
How to do this ?
Just use a step on the range:
for i in range(0, len(a), 15):
print a[i:i+15]
Also note that I changed your len(a)-1 to len(a). Ranges in Python are half-open, meaning you give it the first value, and one past the last value. So, to count the first 26 numbers, from 0 to 25, you use range(26), not range(25).
There may be better ways to write this; for example, with a grouper or chunker function like the one in the itertools recipes:
for group in grouper(a, 15, fillvalue=None):
print filter(None, group)
But the step is the smallest change from what you have.