Hello I'm a beginner in python and I'm confused on where to go from here
How do I interact/click with a specific link after using bs4 to search for it? So in my script I use bs4 to search through links, that can be clicked on in the the webpage, with specific keywords so I click on the right product.
onSale = False # Set while loop variable
shoeName = 'moon' # Set keyword to look for
browser = webdriver.Chrome()
browser.get(r'https://www.nike.com/launch/?s=upcoming') # Get URL to scan
soup = BeautifulSoup(browser.page_source, 'html.parser') # Convert URL to a soup object
while onSale is False: # Create loop to keep checking inventory
for link in soup.find_all('a', class_=r'card-link d-sm-b'):
shoeCode = str((link.get('href', None), link.get_text()))
compareName = re.sub("[^\w]", " ", shoeCode.lower()).split() # Takes the link and converts it into a string
if shoeName in compareName: # Checks to see if the keyword is used
# Interact/Click link
else:
print(shoeCode)
continue
Once the proper link has been found how do I use it to interact with the website? Do I use selenium, urllib, and or requests? Thanks!
You can use selenium to click the links, you can see how to do this here. Or, after fetching the page with requests (forget urllib) and extracting urls with bs4, you can requests.get('your_example_url') it and fetch the results again.
Related
I am trying to pass a link I extracted from beautifulsoup.
import requests
r = requests.get('https://data.ed.gov/dataset/college-scorecard-all-data-files-through-6-2020/resources')
soup = bs(r.content, 'lxml')
links = [item['href'] if item.get('href') is not None else item['src'] for item in soup.select('[href^="http"], [src^="http"]') ]
print(links[1])
This is the link I am wanting.
Output: https://ed-public-download.app.cloud.gov/downloads/CollegeScorecard_Raw_Data_07202021.zip
Now I am trying to pass this link through so I can download the contents.
# make a folder if it doesn't already exist
if not os.path.exists(folder_name):
os.makedirs(folder_name)
# pass the url
url = r'link from beautifulsoup result needs to go here'
response = requests.get(url, stream = True)
# extract contents
with zipfile.ZipFile(io.BytesIO(response.content)) as zf:
for elem in zf.namelist():
zf.extract(elem, '../data')
My overall goal is trying to take the link that I webscraped and place it in the url variable because the link is always changing on this website. I want to make it dynamic so I don't have to manually search for this link and change it when its changing and instead it changes dynamically. I hope this makes sense and appreciate any help I can get.
If I manually enter my code as the following I know it works
url = r'https://ed-public-download.app.cloud.gov/downloads/CollegeScorecard_Raw_Data_07202021.zip'
If I can get my code to pass that exactly I know it'll work I'm just stuck with how to accomplish this.
I think you can do it with the find_all() method in Beautiful Soup
from bs4 import BeautifulSoup
soup = BeautifulSoup(response.content)
for a in soup.find_all('a'):
url = a.get('href')
This question follows this previous question. I want to scrape data from a betting site using Python. I first tried to follow this tutorial, but the problem is that the site tipico is not available from Switzerland. I thus chose another betting site: Winamax. In the tutorial, the webpage tipico is first inspected, in order to find where the betting rates are located in the html file. In the tipico webpage, they were stored in buttons of class “c_but_base c_but". By writing the following lines, the rates could therefore be saved and printed using the Beautiful soup module:
from bs4 import BeautifulSoup
import urllib.request
import re
url = "https://www.tipico.de/de/live-wetten/"
try:
page = urllib.request.urlopen(url)
except:
print(“An error occured.”)
soup = BeautifulSoup(page, ‘html.parser’)
regex = re.compile(‘c_but_base c_but’)
content_lis = soup.find_all(‘button’, attrs={‘class’: regex})
print(content_lis)
I thus tried to do the same with the webpage Winamax. I inspected the page and found that the betting rates were stored in buttons of class "ui-touchlink-needsclick price odd-price". See the code below:
from bs4 import BeautifulSoup
import urllib.request
import re
url = "https://www.winamax.fr/paris-sportifs/sports/1/7/4"
try:
page = urllib.request.urlopen(url)
except Exception as e:
print(f"An error occurred: {e}")
soup = BeautifulSoup(page, 'html.parser')
regex = re.compile('ui-touchlink-needsclick price odd-price')
content_lis = soup.find_all('button', attrs={'class': regex})
print(content_lis)
The problem is that it prints nothing: Python does not find elements of such class (right?). I thus tried to print the soup object in order to see what the BeautifulSoup function was exactly doing. I added this line
print(soup)
When printing it (I do not show it the print of soup because it is too long), I notice that this is not the same text as what appears when I do a right click "inspect" of the Winamax webpage. So what is the BeautifulSoup function exactly doing? How can I store the betting rates from the Winamax website using BeautifulSoup?
EDIT: I have never coded in html and I'm a beginner in Python, so some terminology might be wrong, that's why some parts are in italics.
That's because the website is using JavaScript to display these details and BeautifulSoup does not interact with JS on it's own.
First try to find out if the element you want to scrape is present in the page source, if so you can scrape, pretty much everything! In your case the button/span tag's were not in the page source(meaning hidden or it's pulled through a script)
No <button> tag in the page source :
So I suggest using Selenium as the solution, and I tried a basic scrape of the website.
Here is the code I used :
from selenium import webdriver
option = webdriver.ChromeOptions()
option.add_argument('--headless')
option.binary_location = r'Your chrome.exe file path'
browser = webdriver.Chrome(executable_path=r'Your chromedriver.exe file path', options=option)
browser.get(r"https://www.winamax.fr/paris-sportifs/sports/1/7/4")
span_tags = browser.find_elements_by_tag_name('span')
for span_tag in span_tags:
print(span_tag.text)
browser.quit()
This is the output:
There are some junk data present in this output, but that's for you to figure out what you need and what you don't!
GOAL
(I need to repeatedly do the search for hundreds of times):
1. Search (e.g. "WP_000177210.1") in "https://www.ncbi.nlm.nih.gov/ipg/"
(i.e. https://www.ncbi.nlm.nih.gov/ipg/?term=WP_000177210.1)
2. Select the first record in the second column "CDS Region in Nucleotide" of the table
(i.e. " NC_011415.1 1997353-1998831 (-)", https://www.ncbi.nlm.nih.gov/nuccore/NC_011415.1?from=1997353&to=1998831&strand=2)
3. Select "FASTA" under the name of this sequence
4. Get the fasta sequence
(i.e. ">NC_011415.1:c1998831-1997353 Escherichia coli SE11, complete sequence
ATGACTTTATGGATTAACGGTGACTGGATAACGGGCCAGGGCGCATCGCGTGTGAAGCGTAATCCGGTAT
CGGGCGAG.....").
CODE
1. Search (e.g. "WP_000177210.1") in "https://www.ncbi.nlm.nih.gov/ipg/"
import requests
from bs4 import BeautifulSoup
url = "https://www.ncbi.nlm.nih.gov/ipg/"
r = requests.get(url, params = "WP_000177210.1")
if r.status_code == requests.codes.ok:
soup = BeautifulSoup(r.text,"lxml")
2. Select the first record in the second column "CDS Region in Nucleotide" of the table (In this case " NC_011415.1 1997353-1998831 (-)") (i.e. https://www.ncbi.nlm.nih.gov/nuccore/NC_011415.1?from=1997353&to=1998831&strand=2)
# try 1 (wrong)
## I tried this first, but it seemed like it only accessed to the first level of the href?!
for a in soup.find_all('a', href=True):
if (a['href'][:8]) =="/nuccore":
print("Found the URL:", a['href'])
# try 2 (not sure how to access nested href)
## According to the label I saw in the Develop Tools, I think I need to get the href in the following nested structure. However, it didn't work.
soup.select("html div #maincontent div div div #ph-ipg div table tbody tr td a")
I am stuck in this step right now....
PS
It's my first time to deal with html format. It's also my first time to ask question here. I might not phrase the problem very well. If there's anything wrong, please let me know.
Without using NCBI's REST API,
import time
from bs4 import BeautifulSoup
from selenium import webdriver
# Opens a firefox webbrowser for scrapping purposes
browser = webdriver.Firefox(executable_path=r'your\path\geckodriver.exe') # Put your own path here
# Allows you to load a page completely (with all of the JS)
browser.get('https://www.ncbi.nlm.nih.gov/ipg/?term=WP_000177210.1')
# Delay turning the page into a soup in order to collect the newly fetched data
time.sleep(3)
# Creates the soup
soup = BeautifulSoup(browser.page_source, "html")
# Gets all the links by filtering out ones with just '/nuccore' and keeping ones that include '/nuccore'
links = [a['href'] for a in soup.find_all('a', href=True) if '/nuccore' in a['href'] and not a['href'] == '/nuccore']
Note:
You'll need the package selenium
You'll need to install GeckoDriver
I am quite new to python and am working on a scraping based project- where I am supposed to extract all the contents from links containing a particular search term and place them in a csv file. As a first step, I wrote this code to extract all the links from a website based on a search term entered. I only get a blank screen as output and I am unable to find my mistake.
import urllib
import mechanize
from bs4 import BeautifulSoup
import datetime
def searchAP(searchterm):
newlinks = []
browser = mechanize.Browser()
browser.set_handle_robots(False)
browser.addheaders = [('User-agent', 'Firefox')]
text = ""
start = 0
while "There were no matches for your search" not in text:
url = "http://www.marketing-interactive.com/"+"?s="+searchterm
text = urllib.urlopen(url).read()
soup = BeautifulSoup(text, "lxml")
results = soup.findAll('a')
for r in results:
if "rel=bookmark" in r['href'] :
newlinks.append("http://www.marketing-interactive.com"+ str(r["href"]))
start +=10
return newlinks
print searchAP("digital marketing")
You made four mistakes:
You are defining start but you never use it. (Nor can you, as far as I can see on http://www.marketing-interactive.com/?s=something. There is no url based pagination.) So you endlessly looping over the first set of results.
"There were no matches for your search" is not the no-results string returned by that site. So it would go on forever anyway.
You are appending the link, including http://www.marketing-interactive.com to http://www.marketing-interactive.com. So you would end up with http://www.marketing-interactive.comhttp://www.marketing-interactive.com/astro-launches-digital-marketing-arm-blaze-digital/
Concerning rel=bookmark selection: arifs solution is the proper way to go. But if you really want to do it this way you'd need to something like this:
for r in results:
if r.attrs.get('rel') and r.attrs['rel'][0] == 'bookmark':
newlinks.append(r["href"])
This first checks if rel exists and then checks if its first child is "bookmark", as r['href'] simply does not contain the rel. That's not how BeautifulSoup structures things.
To scrape this specific site you can do two things:
You could do something with Selenium or something else that supports Javascript and press that "Load more" button. But this is quite a hassle.
You can use this loophole: http://www.marketing-interactive.com/wp-content/themes/MI/library/inc/loop_handler.php?pageNumber=1&postType=search&searchValue=digital+marketing
This is the url that feeds the list. It has pagination, so you can easily loop over all results.
The following script extracts all the links from the web page based on given search key. But it does not explore beyond the first page. Although the following code can easily be modified to get all results from multiple pages by manipulating page-number in the URL (as described by Rutger de Knijf in the other answer.).
from pprint import pprint
import requests
from BeautifulSoup import BeautifulSoup
def get_url_for_search_key(search_key):
base_url = 'http://www.marketing-interactive.com/'
response = requests.get(base_url + '?s=' + search_key)
soup = BeautifulSoup(response.content)
return [url['href'] for url in soup.findAll('a', {'rel': 'bookmark'})]
Usage:
pprint(get_url_for_search_key('digital marketing'))
Output:
[u'http://www.marketing-interactive.com/astro-launches-digital-marketing-arm-blaze-digital/',
u'http://www.marketing-interactive.com/singapore-polytechnic-on-the-hunt-for-digital-marketing-agency/',
u'http://www.marketing-interactive.com/how-to-get-your-bosses-on-board-your-digital-marketing-plan/',
u'http://www.marketing-interactive.com/digital-marketing-institute-launches-brand-refresh/',
u'http://www.marketing-interactive.com/entropia-highlights-the-7-original-sins-of-digital-marketing/',
u'http://www.marketing-interactive.com/features/futurist-right-mindset-digital-marketing/',
u'http://www.marketing-interactive.com/lenovo-brings-board-new-digital-marketing-head/',
u'http://www.marketing-interactive.com/video/discussing-digital-marketing-indonesia-video/',
u'http://www.marketing-interactive.com/ubs-melvin-kwek-joins-credit-suisse-as-apac-digital-marketing-lead/',
u'http://www.marketing-interactive.com/linkedins-top-10-digital-marketing-predictions-2017/']
Hope this is what you wanted as the first step for your project.
I need to check a webpage search results and compare them to user input.
ui = raw_input() #for example "Niels Bohr"
link = "http://www.enciklopedija.hr/Trazi.aspx?t=profesor,%20gdje&s=90&k=10"
stranica=urllib.urlopen(link)
soup = BeautifulSoup(stranica, from_encoding="utf-8")
beauty = soup.prettify()
print beauty
since there is 1502 results, my idea was to change the k=10 to k=1502. Now I need some kind of function to check if search results contain my user input. I know that my names are the text after TEXT
so how to do it? maybe using regex?
the second part is if there are matching results to get the link of the results. Again, I know that link is inside that href="", but how to get it out and make it usable=
Finding if Niels Bohr is listed is as easy as using a large batch number and loading the resulting page:
import sys
import urllib2
from bs4 import BeautifulSoup
url = "http://www.enciklopedija.hr/Trazi.aspx?t=profesor,%20gdje&s=0&k={}".format(sys.maxint)
name = u'Bohr, Niels'
page = urllib2.urlopen(url)
soup = BeautifulSoup(page.read())
for link in soup.find_all(class_='AllWordsTextHit', text=name):
print link
This produces any links that contain the text 'Bohr, Niels' as the link text. You can use a regular expression if you need a partial match.
The link object has a (relative) href attribute you can then use to load the next page:
professor_page = 'http://www.enciklopedija.hr/' + link['href']