i am trying to send sql query to my wordpress database using adminer script but the problem im missing somthing needed to be sent as body or headers in my opinion ( if i'm wrong please connect me )
Request raw
POST /REV/adminer-4.7.5-en.php?server=localhost&username=adepfran_wp975&db=adepfran_wp975&sql=select%20*%20from%20wplj_users HTTP/1.1
Host: mywebsite
User-Agent: Mozilla/5.0 (X11; Linux x86_64; rv:60.0) Gecko/20100101 Firefox/60.0
Accept: text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8
Accept-Language: en-US,en;q=0.5
Accept-Encoding: gzip, deflate
Referer: https://mywebsite/REV/adminer-4.7.5-en.php?server=localhost&username=adepfran_wp975&db=adepfran_wp975&sql=
Content-Type: multipart/form-data; boundary=---------------------------1328964205768204682490124619
Content-Length: 425
Cookie: adminer_sid=00e0c898e031284904f8e51b591c1dee; adminer_key=320bc6e9870ffdf2f54982cb2292de87
Connection: close
Upgrade-Insecure-Requests: 1
-----------------------------1328964205768204682490124619
Content-Disposition: form-data; name="query"
select * from wplj_users
-----------------------------1328964205768204682490124619
Content-Disposition: form-data; name="limit"
-----------------------------1328964205768204682490124619
Content-Disposition: form-data; name="token"
401937:659783
-----------------------------1328964205768204682490124619--
Headers raw
-----------------------------1328964205768204682490124619
Content-Disposition: form-data; name="query"
select * from wplj_users
-----------------------------1328964205768204682490124619
Content-Disposition: form-data; name="limit"
-----------------------------1328964205768204682490124619
Content-Disposition: form-data; name="token"
401937:659783
-----------------------------1328964205768204682490124619--
also i intercepted the requests using Burp Suite to clarify further
Request raw
Request parameters
Request Headers
my actual code
ses = requests.Session()
data = {"server": "localhost",
"username": wpuser,
"db": wpdb,
"sql": "SELECT * from wplj_users"}
url="https://mywebsite/REV/adminer-4.7.5-en.php?server=localhost&username=adepfran_wp975&db=adepfran_wp975&sql=SELECT%20*%20from%20wplj_users"
request = ses.post(url,data=data )
the request without limit,query,token (Content-Disposition) does not return the wanted response , how can i pass them ?
It seems you have to send it as files=
For test I used https://httpbin.org which send back all what you get in requests so I can display it and compare with expected data
In files I used (None, "SELECT * from wplj_users") so this None will remove filename="query"
import requests
params = {
'server': 'localhost',
'username': 'adepfran_wp975',
'db': 'adepfran_wp975',
'sql': 'SELECT * from wplj_users',
}
data = {
"query": (None, "SELECT * from wplj_users"),
"limit": (None, ""),
"token": (None, "401937:659783"),
}
headers = {
'User-Agent': 'Mozilla/5.0',
#'Referer': 'https://mywebsite/REV/adminer-4.7.5-en.php?server=localhost&username=adepfran_wp975&db=adepfran_wp975&sql='
# requests.Session() should care of cookies so this header shouldn't be needed
#'Cookie': 'adminer_sid=00e0c898e031284904f8e51b591c1dee; adminer_key=320bc6e9870ffdf2f54982cb2292de87'
}
url = "https://httpbin.org/post"
#url = "https://mywebsite/REV/adminer-4.7.5-en.php"
s = requests.Session()
#r = s.get(url) # to get fresh cookies
r = s.post(url, params=params, headers=headers, files=data)
print('\n=== url ===\n')
print(r.request.url)
print('\n=== headers ===\n')
for key, val in r.request.headers.items():
print('{}: {}'.format(key, val))
print('\n=== body ===\n')
print(r.request.body.decode())
Results
=== url ===
https://httpbin.org/post?server=localhost&username=adepfran_wp975&db=adepfran_wp975&sql=SELECT+%2A+from+wplj_users
=== headers ===
User-Agent: Mozilla/5.0
Accept-Encoding: gzip, deflate
Accept: */*
Connection: keep-alive
Content-Length: 331
Content-Type: multipart/form-data; boundary=79f18e4306b943ea92a49bae21b51b9c
=== body ===
--79f18e4306b943ea92a49bae21b51b9c
Content-Disposition: form-data; name="query"
SELECT * from wplj_users
--79f18e4306b943ea92a49bae21b51b9c
Content-Disposition: form-data; name="limit"
--79f18e4306b943ea92a49bae21b51b9c
Content-Disposition: form-data; name="token"
401937:659783
--79f18e4306b943ea92a49bae21b51b9c--
Related
I'm trying to download a file from Django to client using GCP. Currently, the request is made from axios, the file is fetched from GCP using url from the model. This file is then downloaded and returned as a HTTP response to the client. Inside the network tab, I can see a 200 OK response and the image is visible in the preview. However, the download is not being saved to the client desktop. I would appreciate any suggestions
Download method:
def download(request, pk):
url = Model.objects.get(id=pk).__dict__["file1"]
storage_client = storage.Client()
bucket = storage_client.get_bucket(setting("GS_MEDIA_BUCKET_NAME"))
blob = storage.Blob(url, bucket)
filename = url.rsplit("/", 1)[1]
file_path = "temp/" + filename
file_to_download = open(file_path, "rb")
mime_type, _ = mimetypes.guess_type(file_path)
response = HttpResponse(file_to_download, content_type=mime_type)
response["Content-Disposition"] = "attachment; filename=%s" % filename
return response
Response headers
HTTP/1.1 200 OK
Date: Fri, 29 Oct 2021 08:01:15 GMT
Server: WSGIServer/0.2 CPython/3.9.7
Content-Type: image/jpeg
Content-Disposition: attachment; filename=default.jpg
Vary: Origin
Access-Control-Allow-Origin: http://localhost:3000
X-Frame-Options: SAMEORIGIN
Content-Length: 10994
X-Content-Type-Options: nosniff
Referrer-Policy: same-origin
Request headers
GET /api/models/download/26/ HTTP/1.1
Connection: keep-alive
sec-ch-ua: "Chromium";v="94", "Google Chrome";v="94", ";Not A
Brand";v="99"
Accept: application/json, text/plain, */*
sec-ch-ua-mobile: ?1
User-Agent: Mozilla/5.0 (Linux; Android 6.0; Nexus 5
Build/MRA58N) AppleWebKit/537.36 (KHTML, like Gecko)
Chrome/94.0.4606.81 Mobile Safari/537.36
sec-ch-ua-platform: "Android"
Origin: http://localhost:3000
Sec-Fetch-Site: same-site
Sec-Fetch-Mode: cors
Sec-Fetch-Dest: empty
Accept-Encoding: gzip, deflate, br
Accept-Language: en-US,en;q=0.9
It's a sad day for axios and content-disposition https://medium.com/#drevets/you-cant-prompt-a-file-download-with-the-content-disposition-header-using-axios-xhr-sorry-56577aa706d6
The solution will be along the lines of the following code, from the front-end:
axios({
url: 'http://localhost:5000/static/example.pdf',
method: 'GET',
responseType: 'blob', // important
}).then((response) => {
const url = window.URL.createObjectURL(new Blob([response.data]));
const link = document.createElement('a');
link.href = url;
link.setAttribute('download', 'file.pdf');
document.body.appendChild(link);
link.click();
});
I am trying to send a POST request with Python to upload a file. I'm converting the following sample code to Python but I'm not familiar with how to set this up.
POST /path/to/upload/script HTTP/1.0
Connection: Keep-Alive
User-Agent: My Client App v1.0
Host:
https://bulksell.ebay.com/ws/eBayISAPI.dll?FileExchangeUpload
Content-type: multipart/form-data;
boundary=THIS_STRING_SEPARATES
Content-Length: 256
--THIS_STRING_SEPARATES
Content-Disposition: form-data; name="token"
12345678987654321
--THIS_STRING_SEPARATES
Content-Disposition: form-data; name="file";
filename="listings.csv"
Content-Type: text/csv
... contents of listings.csv ...
--THIS_STRING_SEPARATES
I think I need to set the headers as follows:
headers = {
"Connection": "Keep-Alive",
"User-Agent": "My Client App v1.0",
"Host": "https://bulksell.ebay.com/ws/eBayISAPI.dll?FileExchangeUpload"
"Content-type": "multipart/form-data;"
"Content-Length": "256",
"Host": "https://bulksell.ebay.com/ws/eBayISAPI.dll?FileExchangeUpload",
...
}
Do I need to include these --THIS_STRING_SEPERATES strings?
How do I include my token here? The example just sends it alone.
What would be the correct way to format this for a request.post?
Thank you.
I have made a post requests with multipart/form-data; boundary=a1c2469c-2a1f-48e6-8f1d-311f8650c855 And I get this
POST /api/feed/upload-resource HTTP/1.1
App-Id: 15762288
Version-Name: 3.26.0.451
User-Agent: Right-Android/3.26.0.451
Content-Type: multipart/form-data; boundary=a1c2469c-2a1f-48e6-8f1d-311f8650c855
Content-Length: 75412
Connection: Keep-Alive
Accept-Encoding: gzip
--a1c2469c-2a1f-48e6-8f1d-311f8650c855
Content-Disposition: form-data; name="h"
Content-Length: 4
1080
--a1c2469c-2a1f-48e6-8f1d-311f8650c855
Content-Disposition: form-data; name="w"
Content-Length: 4
1080
--a1c2469c-2a1f-48e6-8f1d-311f8650c855
Content-Disposition: form-data; name="image"; filename="/storage/emulated/0/Android/data/com.xiaoyu.rightone/tiny/tiny-738-2018-08-03-15-32-53.jpg"
Content-Type: text/plain
Content-Length: 74910
If I want to simulate this request using Python requests package How can I do that.
I have checked the document, and I have tried use file parameter like this
with open(path, 'rb') as f:
files = {
"h": "1495",
"w": "840",
"filename": ("image", f.read()),
}
r = requests.post(url, files=files)
However in my situation, I always get an error like upload_resource_empty.
This should work:
import requests
files = {
'image': ('file_name.jpg', open('file.jpg', 'rb'), 'text/plain'),
'w': (None, '123'),
'h': (None, '222')
}
response = requests.post('url', files=files)
The tuples in the dictionary have the following format: ('filename', fileobj, 'content_type', custom_headers)
I am using Python's (3.5.2) requests library (2.12.4) to post a query to the Primer-BLAST website. Below is the script I've written for this task:
#!/usr/bin/env python
import requests
# BaseURL being accessed
url = 'https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi'
# Dictionary of query parameters
data = {
'INPUT_SEQUENCE' : 'TCTTCTGAGAAAGTCTGAGGCTCCTTAGTACCTTCTCTAGTATGAACTGTTCAGCCTGCCCGCAAGTTGTAACTACGCAGGCGCCAAGACAGCCAACCAAGGAGGCTGCAGA',
'ORGANISM' : 'Mus musculus'
}
# Make a POST request and read the response
with requests.session() as session:
poster = session.post(url, data=data)
for key, value in poster.headers.items():
print(key, ':', value)
I need to retrieve the NCBI-RCGI-RetryURL field from the response's header information. However, I can only see this field when I use the HTTP trace extension in Google Chrome. Below is the full trace of the POST and response using Google Chrome:
POST https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi
Origin: https://www.ncbi.nlm.nih.gov
Upgrade-Insecure-Requests: 1
User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10_12_6) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/60.0.3112.101 Safari/537.36
Content-Type: multipart/form-data; boundary=----WebKitFormBoundaryBflp51Ny9ReeA5A9
Accept: text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8
Referer: https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=reset
Accept-Encoding: gzip, deflate, br
Accept-Language: en-US,en;q=0.8
Cookie: sv-userdata-key-www.ncbi.nlm.nih.gov=G5KxXzyQ81U_vs1aHK_7XDWciF1B8AjjDUmDunVbhIZhZ4p4t_SVK4ASpbTT8iDSJVcxBH9oUAB3K2xNWjp3G0koYCloBlYuSxdoIGIkYzl2; ncbi_sid=0751457F9A561D01_0000SID; _ga=GA1.2.567134514.1503994317; _gid=GA1.2.654339584.1503994317; _gat=1; starnext=MYGwlsDWB2CmAeAXAXAbgK7RAewIYBM4lkAmAXgAcAnMAW1ioCMRcBnRAMgBYzm3FWsXFWAALDgEZymHAUkBOMgAYA7AFYpXFQDF5AQTUA2ACIBRFRKVXrN2xI4klygMJcSltQA59R0wGY/S1tg63t3Shp6JhZ2AFI/PQA5AHlE03i9PnZBYTEMlLSHcgB3UoA6aGBGMAqQWgqwUTKAc2wANwceajoGLMR81NMHQwie6P4BtIy+nJFxEhVRqL7J9ISZoTnVh08l3pj+lWcC9KON3NFYo5OHRQkuLiUOPyd5K2eJMnvH5/JPDWefjIADNcCBBM8eIgqOhYM81F83GpniMJH4SPJnosSFxnrtAoZ5Li/IoXp5DCpuE50RIpNxPlIAtxyNBcIgwG04Q8yDI8IQEJwuAiSBw1EDvk81DxPEo/KKEfIRUYyCRDIZRYtJbtaT81HcOIYnE9DAycUA=
HTTP/1.1 200 OK
Date: Tue, 29 Aug 2017 13:38:27 GMT
Server: Apache
Strict-Transport-Security: max-age=31536000; includeSubDomains; preload
Referrer-Policy: origin-when-cross-origin
Content-Security-Policy: upgrade-insecure-requests
Cache-Control: no-cache, no-store, max-age=0, private, must-revalidate
Expires: 0
NCBI-PHID: 0C421A7A9A56E5310000000000000001.m_2
NCBI-RCGI-RetryURL: https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1504013907&job_key=aWO2H68Wor6FhLSBueGQs8P6gYHu6Zqc7w
NCBI-SID: 0751457F9A561D01_0000SID
Pragma: no-cache
Access-Control-Allow-Methods: POST, GET, PUT, OPTIONS, PATCH, DELETE
Access-Control-Allow-Origin: https://www.ncbi.nlm.nih.gov
Access-Control-Allow-Credentials: true
Access-Control-Allow-Headers: Origin,X-Accept-Charset,X-Accept,Content-Type,X-Requested-With,NCBI-SID,NCBI-PHID
Content-Type: text/html
Set-Cookie: ncbi_sid=0751457F9A561D01_0000SID; domain=.nih.gov; path=/; expires=Wed, 29 Aug 2018 13:38:27 GMT
Vary: Accept-Encoding
Content-Encoding: gzip
X-UA-Compatible: IE=Edge
X-XSS-Protection: 1; mode=block
Keep-Alive: timeout=1, max=9
Connection: Keep-Alive
Transfer-Encoding: chunked
And here is all the header information I get from my script:
Date : Tue, 29 Aug 2017 14:41:08 GMT
Server : Apache
Strict-Transport-Security : max-age=31536000; includeSubDomains; preload
Referrer-Policy : origin-when-cross-origin
Content-Security-Policy : upgrade-insecure-requests
Accept-Ranges : bytes
Vary : Accept-Encoding
Content-Encoding : gzip
X-UA-Compatible : IE=Edge
X-XSS-Protection : 1; mode=block
Content-Length : 2516
Keep-Alive : timeout=1, max=10
Connection : Keep-Alive
Content-Type : text/html
The NCBI-RCGI-RetryURL field is important because it contains the URL I need to execute a GET request on in order to retrieve the results.
EDIT:
Updated script as per Maurice Meyer's suggestion:
#!/usr/bin/env python
import requests
# BaseURL being accessed
url = 'https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi'
# Dictionary of query parameters
data = {
'INPUT_SEQUENCE' : 'TCTTCTGAGAAAGTCTGAGGCTCCTTAGTACCTTCTCTAGTATGAACTGTTCAGCCTGCCCGCAAGTTGTAACTACGCAGGCGCCAAGACAGCCAACCAAGGAGGCTGCAGA',
'ORGANISM' : 'Mus musculus'
}
# Extra headers
headers = {
'Origin' : 'https://www.ncbi.nlm.nih.gov',
'Upgrade-Insecure-Requests' : '1',
'User-Agent' : 'Mozilla/5.0 (Macintosh; Intel Mac OS X 10_12_6) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/60.0.3112.101 Safari/537.36',
'Content-Type' : 'multipart/form-data; boundary=----WebKitFormBoundaryBflp51Ny9ReeA5A9',
'Accept' : 'text/html,application/xhtml+xml,application/xml;q=0.9,image/webp,image/apng,*/*;q=0.8',
'Referer' : 'https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=reset',
'Accept-Encoding' : 'gzip, deflate, br',
'Accept-Language' : 'en-US,en;q=0.8',
'Cookie' : 'sv-userdata-key-www.ncbi.nlm.nih.gov=G5KxXzyQ81U_vs1aHK_7XDWciF1B8AjjDUmDunVbhIZhZ4p4t_SVK4ASpbTT8iDSJVcxBH9oUAB3K2xNWjp3G0koYCloBlYuSxdoIGIkYzl2; ncbi_sid=0751457F9A561D01_0000SID; _ga=GA1.2.567134514.1503994317; _gid=GA1.2.654339584.1503994317; _gat=1; starnext=MYGwlsDWB2CmAeAXAXAbgK7RAewIYBM4lkAmAXgAcAnMAW1ioCMRcBnRAMgBYzm3FWsXFWAALDgEZymHAUkBOMgAYA7AFYpXFQDF5AQTUA2ACIBRFRKVXrN2xI4klygMJcSltQA59R0wGY/S1tg63t3Shp6JhZ2AFI/PQA5AHlE03i9PnZBYTEMlLSHcgB3UoA6aGBGMAqQWgqwUTKAc2wANwceajoGLMR81NMHQwie6P4BtIy+nJFxEhVRqL7J9ISZoTnVh08l3pj+lWcC9KON3NFYo5OHRQkuLiUOPyd5K2eJMnvH5/JPDWefjIADNcCBBM8eIgqOhYM81F83GpniMJH4SPJnosSFxnrtAoZ5Li/IoXp5DCpuE50RIpNxPlIAtxyNBcIgwG04Q8yDI8IQEJwuAiSBw1EDvk81DxPEo/KKEfIRUYyCRDIZRYtJbtaT81HcOIYnE9DAycUA='
}
# Make a POST request and read the response
with requests.session() as session:
poster = session.post(url, data=data, headers=headers)
for key, value in poster.headers.items():
print(key, ':', value)
Updated output, still no difference:
Date : Tue, 29 Aug 2017 15:05:27 GMT
Server : Apache
Strict-Transport-Security : max-age=31536000; includeSubDomains; preload
Referrer-Policy : origin-when-cross-origin
Content-Security-Policy : upgrade-insecure-requests
Accept-Ranges : bytes
Vary : Accept-Encoding
Content-Encoding : gzip
X-UA-Compatible : IE=Edge
X-XSS-Protection : 1; mode=block
Content-Length : 2517
Keep-Alive : timeout=1, max=10
Connection : Keep-Alive
Content-Type : text/html
The request data between the two is totally different.
Specifically the request body data. So it really isn't missing header information using Python's requests library - it is missing information the in POST request to server.
You can't simply copy and paste the header
'Content-Type' : 'multipart/form-data; boundary=----WebKitFormBoundaryBflp51Ny9ReeA5A9',
Or just post the data INPUT_SEQUENCE and ORGANISM like that - also in any case the data you do have for ORGANISM is clearly wrong - a cursory glance shows it would be Mus musculus (taxid:10090) not Mus musculus.
So - you need to look at the whole request - headers and body, then craft a request that includes the required data by the server. Looking at it you are missing loads and loads of data that the server will need to respond.
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="INPUT_SEQUENCE"
TCTTCTGAGAAAGTCTGAGGCTCCTTAGTACCTTCTCTAGTATGAACTGTTCAGCCTGCCCGCAAGTTGTAACTACGCAGGCGCCAAGACAGCCAACCAAGGAGGCTGCAGA
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="SEQFILE"; filename=""
Content-Type: application/octet-stream
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER5_START"
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER5_END"
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER3_START"
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER3_END"
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_LEFT_INPUT"
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_RIGHT_INPUT"
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_PRODUCT_MIN"
70
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_PRODUCT_MAX"
1000
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_NUM_RETURN"
10
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_MIN_TM"
57.0
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_OPT_TM"
60.0
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_MAX_TM"
63.0
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_MAX_DIFF_TM"
3
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_ON_SPLICE_SITE"
0
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="SPLICE_SITE_OVERLAP_5END"
7
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="SPLICE_SITE_OVERLAP_3END"
4
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="MIN_INTRON_SIZE"
1000
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="MAX_INTRON_SIZE"
1000000
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="SEARCH_SPECIFIC_PRIMER"
on
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="SEARCHMODE"
0
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="PRIMER_SPECIFICITY_DATABASE"
refseq_mrna
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="CUSTOM_DB"
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="CUSTOMSEQFILE"; filename=""
Content-Type: application/octet-stream
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
Content-Disposition: form-data; name="ORGANISM"
Mus musculus (taxid:10090)
------WebKitFormBoundaryJVAJqDi2cI4BTfmc
etc...
I am trying to write an automatic subtitle finder in Python 3.x using The SubDB (http://thesubdb.com/api/). I'm now working on an upload feature. However, I cannot get it to work. I keep getting a 415 error (Unsupported Media Type). On the SubDB website, a 'request sample' is given:
POST /?action=upload HTTP/1.1
Host: api.thesubdb.com
User-Agent: SubDB/1.0 (Pyrrot/0.1; http://github.com/jrhames/pyrrot-cli)
Content-Length: 60047
Content-Type: multipart/form-data; boundary=xYzZY
- - --xYzZY
Content-Disposition: form-data; name="hash"
edc1981d6459c6111fe36205b4aff6c2
- - --xYzZY
Content-Disposition: form-data; name="file"; filename="subtitle.srt"
Content-Type: application/octet-stream
[PAYLOAD]
But I do not know how to interpret this and I couldn't find an answer online. This is my current code:
def uploadSubtitle(hash, path):
params = {'action': "upload", 'hash': hash}
response = requests.post(
url=base_url.format(urllib.parse.urlencode(params)),
data=open(path,'r').read(),
headers = {
'User-Agent': user_agent,
'Content-Length': 51200,
'Content-Type': "multipart/form-data; boundary=xYzZY",
'Host': "api.thesubdb.com"
}
)
return response.status_code
Any advice would be greatly appreciated!
I was having the same issues.
You may want to see this https://github.com/ivandrofly/SubDBSharp
Try following:
POST /?action=upload HTTP/1.1
Host: api.thesubdb.com
User-Agent: SubDB/1.0 (Pyrrot/0.1; http://github.com/jrhames/pyrrot-cli)
Content-Length: [Subtitle content length including boundary length]
Content-Type: multipart/form-data; boundary=xYzZY
--xYzZY
Content-Disposition: form-data; name="hash"
edc1981d6459c6111fe36205b4aff6c2
--xYzZY
Content-Disposition: form-data; name="file"; filename="subtitle.srt"
Content-Type: application/octet-stream
[SUBTITLE CONTENT]
--xYzZY
# Content-Length:
Content length should be from --xYzZY to last --xYzZY see above.
Note: Boundary started --xYzZY and ends after [SUBTITLE CONTENT]