Develop Reference

How to set attributes in pandasdmx

The "pandasdmx" documentation has an example of how to set dimensions, but no how to set attributes.
I tried passing "key" to the variable, but an error occurs.
Perhaps setting attributes requires a different syntax?
At the end of my sample code, I printed out a list of dimensions and attributes.
import pandasdmx as sdmx
import pandas as pd
ecb = sdmx.Request('ECB')
key = dict(FREQ=['M'], SEC_ITEM=['F51100'], REF_AREA = ['I8'], SEC_ISSUING_SECTOR = ['1000'])
params = dict(startPeriod='2010-02', endPeriod='2010-02')
data_msg = ecb.data('SEC', key=key, params=params)
data = data_msg.data[0]
daily = [s for sk, s in data.series.items() if sk.FREQ == 'M']
cur_df = pd.concat(sdmx.to_pandas(daily)).unstack()
print(cur_df.to_string())
flow_msg = ecb.dataflow()
dataflows = sdmx.to_pandas(flow_msg.dataflow)
exr_msg = ecb.dataflow('SEC')
exr_flow = exr_msg.dataflow.SEC
dsd = exr_flow.structure
dimen = dsd.dimensions.components
attrib = dsd.attributes.components
print(dimen)
print(attrib)

To clarify, what you're asking here is not “how to set attributes” but “how to include attributes when converting (or ‘writing’) an SDMX DataSet to a pandas DataFrame”.
Using sdmx1,¹ see the documentation for the attribute parameter to the write_dataset() function. This is the function that is ultimately called by to_pandas() when you pass a DataSet object as the first argument.
In your sample code, the key line is:
sdmx.to_pandas(daily)
You might try instead:
sdmx.to_pandas(data_msg.data[0], attributes="dsgo")
Per the documentation, the string "dsgo" means “include in additional columns all attributes attached at the dataset, series key, group, and observation levels.”
¹ sdmx1 is a fork of pandaSDMX with many enhancements and more regular releases.

How to get id(address) of each value in list in python like pointer C?

First of all, I'm not good at English, sorry.
I'm trying to get id of list in python, to make each variable get filtered value by locale function.
Please check out the code below.
dayLow ="123124"
dayHigh = "200000"
volume = "21512542"
marketCap = "235136346137"
toLocale = [dayLow, dayHigh, volume, marketCap]
afterLocale = list()
def locale(inform_data):
inform_data = f"{inform_data:,}"
return inform_data
for item in toLocale:
item = locale(int(item))
afterLocale.append(item)
i = 0
while(i < afterLocale):
id(toLocale[i]) = afterLocale[i]
i += 1
and it's not working, and spit error out like that.
File "c:\******\test.py", line 19
id(toLocale[i]) = afterLocale[i]
^
SyntaxError: cannot assign to function call
So the question is
How can each variable in toLocale(dayLow, dayHigh, ...) gets the value filtered by function locale()?

You can't assign to a variable by using it's id() - that's not what id() is for.
If you want to dynamically assign variables to values, you can use exec to do so.
But I WOULD HIGHLY RECOMMEND NOT DOING SO.
Just type out the extra code required. It'll save you a lot of headache in the long run
dayLow ="123124"
dayHigh = "200000"
volume = "21512542"
marketCap = "235136346137"
toLocale = {'dayLow': dayLow, 'dayHigh': dayHigh, 'volume': volume, 'marketCap': marketCap}
def locale(inform_data):
inform_data = f"{inform_data:,}"
return inform_data
for var_name, var_value in toLocale.items():
exec(f'{var_name} = "{locale(int(var_value))}"')
print(dayLow, dayHigh, volume, marketCap)
Output:
123,124 200,000 21,512,542 235,136,346,137

I'm not sure if this is what exactly you want, but if you are trying to translate the values, using a dictionary would be maybe better for your usecase:
items = {
"dayLow": 123124,
"dayHigh" 200000,
"volume": 21512542,
"marketCap": 235136346137,
}
# now you can use `locale` for the keys:
for name, value in items.values():
# `name` will have a value of "dayLow", "dayHigh" etc...
print(locale(name), value)

Variable indexed by an indexed Set with Pyomo

im trying to figure out how to index a variable with an indexed Set:
For example:
model = AbstractModel()
model.J = Set()
model.O = Set(model.J)
I want to define a variable indexed over both Sets. Can Someone help me? I tried the following:
model.eb=Param(model.J, model.O)
which gives
TypeError("Cannot index a component with an indexed set")
Has anyone any suggestions on how to define this variable properly?

Pyomo doesn't support indexed Sets like that (I'm actually unaware of use cases for indexed sets in Pyomo, although they seem to be a thing in GAMS). You could approach this as follows (using ConcreteModel here, for illustration):
Define Sets for all unique values of jobs and operations (I assume you have some data structure which maps the operations to the jobs):
import pyomo.environ as po
import itertools
model = po.ConcreteModel()
map_J_O = {'J1': ['O11', 'O12'],
'J2': ['O21']}
unique_J = map_J_O.keys()
model.J = po.Set(initialize=unique_J)
unique_O = set(itertools.chain.from_iterable(map_J_O.values()))
model.O = po.Set(initialize=unique_O)
Then you could define a combined Set which contains all valid combinations of J and O:
model.J_O = po.Set(within=model.J * model.O,
initialize=[(j, o) for j in map_J_O for o in map_J_O[j]])
model.J_O.display()
# Output:
#J_O : Dim=0, Dimen=2, Size=3, Domain=J_O_domain, Ordered=False, Bounds=None
# [('J1', 'O11'), ('J1', 'O12'), ('J2', 'O21')]
Create the parameter using the combined Set:
model.eb = po.Param(model.J_O)
This last line will throw an error the parameter is initialized using any non-valid combination of J and O. Alternatively, you can also initialize the parameter for all combinations
po.Param(model.J * model.O)
and only initialize for the valid combinations, but this might bite you later. Also, model.J_O might be handy also for variables and constraints, depending on your model formulation.

python return double entry in dictionary

I am searching for hours and hours on this problem and tried everything possible but I can't get it cracked, I am quiet a dictionary noob.
I work with maya and got clashing names of lights, this happens when you duplicate a group all children are named the same as before, so having a ALL_KEY in one group results in a clashing name with a key_char in another group.
I need to identify a clashing name of the short name and return the long name so I can do a print long name is double or even a cmds.select.
Unfortunately everything I find on this matter in the internet is about returning if a list contains double values or not and only returns True or False, which is useless for me, so I tried list cleaning and list comparison, but I get stuck with a dictionary to maintain long and short names at the same time.
I managed to fetch short names if they are duplicates and return them, but on the way the long name got lost, so of course I can't identify it clearly anymore.
>import itertools
>import fnmatch
>import maya.cmds as mc
>LIGHT_TYPES = ["spotLight", "areaLight", "directionalLight", "pointLight", "aiAreaLight", "aiPhotometricLight", "aiSkyDomeLight"]
#create dict
dblList = {'long' : 'short'}
for x in mc.ls (type=LIGHT_TYPES, transforms=True):
y = x.split('|')[-1:][0]
dblList['long','short'] = dblList.setdefault(x, y)
#reverse values with keys for easier detection
rev_multidict = {}
for key, value in dblList.items():
rev_multidict.setdefault(value, set()).add(key)
#detect the doubles in the dict
#print [values for key, values in rev_multidict.items() if len(values) > 1]
flattenList = set(itertools.chain.from_iterable(values for key, values in rev_multidict.items() if len(values) > 1))
#so by now I got all the long names which clash in the scene already!
#means now I just need to make a for loop strip away the pipes and ask if the object is already in the list, then return the path with the pipe, and ask if the object is in lightlist and return the longname if so.
#but after many many hours I can't get this part working.
##as example until now print flattenList returns
>set([u'ALL_blockers|ALL_KEY', u'ABCD_0140|scSet', u'SARAH_TOPShape', u'ABCD_0140|scChars', u'ALL|ALL_KEY', u'|scChars', u'|scSet', u'|scFX', ('long', 'short'), u'ABCD_0140|scFX'])
#we see ALL_KEY is double! and that's exactly what I need returned as long name
#THIS IS THE PART THAT I CAN'T GET WORKING, CHECK IN THE LIST WHICH VALUES ARE DOUBLE IN THE LONGNAME AND RETURN THE SHORTNAME LIST.
THE WHOLE DICTIONARY IS STILL COMPLETE AS
seen = set()
uniq = []
for x in dblList2:
if x[0].split('|')[-1:][0] not in seen:
uniq.append(x.split('|')[-1:][0])
seen.add(x.split('|')[-1:][0])
thanks for your help.

I'm going to take a stab with this. If this isn't what you want let me know why.
If I have a scene with a hierarchy like this:
group1
nurbsCircle1
group2
nurbsCircle2
group3
nurbsCircle1
I can run this (adjust ls() if you need it for selection or whatnot):
conflictObjs = {}
objs = cmds.ls(shortNames = True, transforms = True)
for obj in objs:
if len( obj.split('|') ) > 1:
conflictObjs[obj] = obj.split('|')[-1]
And the output of conflictObjs will be:
# Dictionary of objects with non-unique short names
# {<long name>:<short name>}
{u'group1|nurbsCircle1': u'nurbsCircle1', u'group3|nurbsCircle1': u'nurbsCircle1'}
Showing me what objects don't have unique short names.

This will give you a list of all the lights which have duplicate short names, grouped by what the duplicated name is and including the full path of the duplicated objects:
def clashes_by_type(*types):
long_names = cmds.ls(type = types, l=True) or []
# get the parents from the lights, not using ls -type transform
long_names = set(cmds.listRelatives(*long_names, p=True, f=True) or [])
short_names = set([i.rpartition("|")[-1] for i in long_names])
short_dict = dict()
for sn in short_names:
short_dict[sn] = [i for i in long_names if i.endswith("|"+ sn)]
clashes = dict((k,v) for k, v in short_dict.items() if len(v) > 1)
return clashes
clashes_by_type('directionalLight', 'ambientLight')The main points to note:
work down from long names. short names are inherently unreliable!
when deriving the short names, include the last pipe so you don't get accidental overlaps of common names
short_names will always be a list of lists since it's created by a comprehension
once you have a dict of (name, [objects with that shortname]) it's easy to get clashes by looking for values longer than 1

Constantly getting IndexError and am unsure why in Python

I am new to python and really programming in general and am learning python through a website called rosalind.info, which is a website that aims to teach through problem solving.
Here is the problem, wherein you're asked to calculate the percentage of guanine and thymine to the string of DNA given to for each ID, then return the ID of the sample with the greatest percentage.
I'm working on the sample problem on the page and am experiencing some difficulty. I know my code is probably really inefficient and cumbersome but I take it that's to be expected for those who are new to programming.
Anyway, here is my code.
gc = open("rosalind_gcsamp.txt","r")
biz = gc.readlines()
i = 0
gcc = 0
d = {}
for i in xrange(biz.__len__()):
if biz[i].startswith(">"):
biz[i] = biz[i].replace("\n","")
biz[i+1] = biz[i+1].replace("\n","") + biz[i+2].replace("\n","")
del biz[i+2]
What I'm trying to accomplish here is, given input such as this:
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
Break what's given into a list based on the lines and concatenate the two lines of DNA like so:
['>Rosalind_6404', 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG', 'TCCCACTAATAATTCTGAGG\n']
And delete the entry two indices after the ID, which is >Rosalind. What I do with it later I still need to figure out.
However, I keep getting an index error and can't, for the life of me, figure out why. I'm sure it's a trivial reason, I just need some help.
I've even attempted the following to limited success:
for i in xrange(biz.__len__()):
if biz[i].startswith(">"):
biz[i] = biz[i].replace("\n","")
biz[i+1] = biz[i+1].replace("\n","") + biz[i+2].replace("\n","")
elif biz[i].startswith("A" or "C" or "G" or "T") and biz[i+1].startswith(">"):
del biz[i]
which still gives me an index error but at least gives me the biz value I want.
Thanks in advance.

It is very easy do with itertools.groupby using lines that start with > as the keys and as the delimiters:
from itertools import groupby
with open("rosalind_gcsamp.txt","r") as gc:
# group elements using lines that start with ">" as the delimiter
groups = groupby(gc, key=lambda x: not x.startswith(">"))
d = {}
for k,v in groups:
# if k is False we a non match to our not x.startswith(">")
# so use the value v as the key and call next on the grouper object
# to get the next value
if not k:
key, val = list(v)[0].rstrip(), "".join(map(str.rstrip,next(groups)[1],""))
d[key] = val
print(d)
{'>Rosalind_0808': 'CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT', '>Rosalind_5959': 'CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCTATATCCATTTGTCAGCAGACACGC', '>Rosalind_6404': 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG'}
If you need order use a collections.OrderedDict in place of d.

You are looping over the length of biz. So in your last iteration biz[i+1] and biz[i+2] don't exist. There is no item after the last.