Develop Reference

Python Print Hex variable

I have hex variable that I want to print as hex
data = '\x99\x02'
print (data)
Result is: ™
I want to the python to print 0x9902
Thank you for your help

Please check this one.
data = r'\x99\x02'
a, b = [ x for x in data.split(r'\x') if x]
d = int(a+b, base=16)
print('%#x'%d)

You have to convert every char to its number - ord(char) - and convert every number to hex value - '{:02x}'.format() - and concatenate these values to string. And add string '0x'.
data = '\x99\x02'
print('0x' + ''.join('{:02x}'.format(ord(char)) for char in data))
EDIT: The same but first string is converted to bytes using encode('raw_unicode_escape')
data = '\x99\x02'
print('0x' + ''.join('{:02x}'.format(code) for code in data.encode('raw_unicode_escape')))
and if you have already bytes then you don't have to encode()
data = b'\x99\x02'
print('0x' + ''.join('{:02x}'.format(code) for code in data))
BTW: Similar way you can convert to binary using {:08b}
data = '\x99\x02'
print(''.join('{:08b}'.format(code) for code in data.encode('raw_unicode_escape')))

Convert String to hex and send via serial in Python

I want to convert the string 400AM49L01 to a hexadecimal form (and then into bytes) b'x\34\x30\x30\x41\x4d\x34\x39\x4c\x30', so I can write it with pySerial.
I already tried to convert the elements of a list, which contains the single hexadecimals like 0x31 (equals 4), into bytes, but this will result in b'400AM49L01'.
device = '400AM49L01'
device = device.encode()
device = bytes(device)
device = str(binascii.hexlify(device), 'ascii')
code = '0x'
text = []
count = 0
for i in device:
if count % 2 == 0 and count != 0:
text.append(code)
code = '0x'
count = 0
code += i
count += 1
text.append((code))
result = bytes([int(x, 0) for x in text])
Really looking forward for your help!

The following code will give the result you expecting.
my_str = '400AM49L01'
"".join(hex(ord(c)) for c in my_str).encode()
# Output
# '0x340x300x300x410x4d0x340x390x4c0x300x31'
What is it doing ?
In order to convert a string to hex, you need to convert each character to the integer value from the ascii table using ord().
Convert each int value to hex using the function hex().
Concatenate all hex value generated using join().
Encode the str to bytes using .encode().
Regards!

translate a string message into a set of numbers python

I implemented a RSA algorithm on python. But I have a problem with the fact that you need to present any message in numerical form (a set of digits) in order to raise to a power. The difficulty is that if you do this with the ascii, how do you know how many digits are in the ascii code of the character 1, 2 or 3, for the unambiguous decode. Are there other options?
def decodeMessage(self, encodedMessage):
decodedBlocks = []
for block in encodedMessage:
decoded = self.mod_exp(block, self.e, self.N)
decodedBlocks.append(decoded)
return decodedBlocks

Found a solution in binascii, which gives me the conversion of a string into a set of numbers.
message = message.strip()
b = message.encode('utf-8')
hex_data = binascii.hexlify(b)
cipher = int(hex_data, 16)
after all the manipulations I convert back:
h2 = hex(result)[2:]
b2 = h2.encode('ascii')
b3 = binascii.unhexlify(b2)
answer = b3.decode('utf-8')

Convert file to binary code in Python

I am looking to convert a file to binary for a project, preferably using Python as I am most comfortable with it, though if walked-through, I could probably use another language.
Basically, I need this for a project I am working on where we want to store data using a DNA strand and thus need to store files in binary ('A's and 'T's = 0, 'G's and 'C's = 1)
Any idea how I could proceed? I did find that use could encode in base64, then decode it, but it seems a bit inefficient, and the code that I have doesn't seem to work...
import base64
import tkinter as tk
from tkinter import filedialog
root = tk.Tk()
root.withdraw()
file_path = filedialog.askopenfilename()
print(file_path)
with open(file_path) as f:
encoded = base64.b64encode(f.readlines())
print(encoded)
Also, I already have a program to do that simply with text. Any tips on how to improve it would also be appreciated!
import binascii
t = bytearray(str(input("Texte?")), 'utf8')
h = binascii.hexlify(t)
b = bin(int(h, 16)).replace('b','')
#removing the b that appears in the end for some reason
g = b.replace('1','G').replace('0','A')
print(g)
For example, if I input test:
ok so for the text to DNA:
I input 'test' and expect the DNA sequence that comes from the binary
the binary being: 01110100011001010111001101110100 (Also I asked to print every conversion in the example so that it is more comprehensible)
>>>Texte?test #Asks the text
>>>b'74657374' #converts to hex
>>>01110100011001010111001101110100 #converts to binary
>>>AGGGAGAAAGGAAGAGAGGGAAGGAGGGAGAA #converts 0 to A and 1 to G

So, thanks to #jonrshape and Sergey Vturin, I finally was able to achieve what I wanted!
My program asks for a file, turns it into binary, which then gives me its equivalent in "DNA code" using pairs of binary numbers (00 = A, 01 = T, 10 = G, 11 = C)
import binascii
from tkinter import filedialog
file_path = filedialog.askopenfilename()
x = ""
with open(file_path, 'rb') as f:
for chunk in iter(lambda: f.read(32), b''):
x += str(binascii.hexlify(chunk)).replace("b","").replace("'","")
b = bin(int(x, 16)).replace('b','')
g = [b[i:i+2] for i in range(0, len(b), 2)]
dna = ""
for i in g:
if i == "00":
dna += "A"
elif i == "01":
dna += "T"
elif i == "10":
dna += "G"
elif i == "11":
dna += "C"
print(x) #hexdump
print(b) #converted to binary
print(dna) #converted to "DNA"

Of course, it is inefficient!
base64 is designed to store binary in a text. It makes a bigger size block after conversion.
btw: what efficiency do you want? compactness?
if so: second sample is much nearer to what you want
btw: in your task you loose information! Are you aware of this?
Here is a sample how to store and restore.
It stores data in an easy to understand Hex-In-Text format -- just for the sake of a demo. If you want compactness - you can easily modify the code so as to store in binary file or if you want 00011001 view - modification will be easy too.
import math
#"make a long test string"
import numpy as np
s=''.join((str(x) for x in np.random.randint(4,size=33)))\
.replace('0','A').replace('1','T').replace('2','G').replace('3','C')
def store_(s):
size=len(s) #size will changed to fit 8*integer so remember true value of it and store with data
s2=s.replace('A','0').replace('T','0').replace('G','1').replace('C','1')\
.ljust( int(math.ceil(size/8.)*8),'0') #add '0' to 8xInt to the right
a=(hex( eval('0b'+s2[i*8:i*8+8]) )[2:].rjust(2,'0') for i in xrange(len(s2)/8))
return ''.join(a),size
yourDataAsHexInText,sizeToStore=store_(s)
print yourDataAsHexInText,sizeToStore
def restore_(s,size=None):
if size==None: size=len(s)/2
a=( bin(eval('0x'+s[i*2:i*2+2]))[2:].rjust(8,'0') for i in xrange(len(s)/2))
#you loose information, remember?, so it`s only A or G
return (''.join(a).replace('1','G').replace('0','A') )[:size]
restore_(yourDataAsHexInText,sizeToStore)
print "so check it"
print s ,"(input)"
print store_(s)
print s.replace('C','G').replace('T','A') ,"to compare with information loss"
print restore_(*store_(s)),"restored"
print s.replace('C','G').replace('T','A') == restore_(*store_(s))
result in my test:
63c9308a00 33
so check it
AGCAATGCCGATGTTCATCGTATACTTTGACTA (input)
('63c9308a00', 33)
AGGAAAGGGGAAGAAGAAGGAAAAGAAAGAGAA to compare with information loss
AGGAAAGGGGAAGAAGAAGGAAAAGAAAGAGAA restored
True

Encrypting the lines in a file

I'm trying to write a program that opens a text file, and shifts each of the characters in the file 5 characters to the right. It should only do this for alphanumeric characters, and leave nonalphanumerics as they are. (ex: C becomes H) I'm supposed to be using the ASCII table to do this, and I'm having an issue when the characters wrap around. ex: w should become b, but my program gives me a character that's in the ASCII table. Another issue I'm having is that all the characters are printing on separate lines and I'd like them all to print on the same line.
I can't use lists or dictionaries.
This is what I have, I'm not sure how to do the final if statement
def main():
fileName= input('Please enter the file name: ')
encryptFile(fileName)
def encryptFile(fileName):
f= open(fileName, 'r')
line=1
while line:
line=f.readline()
for char in line:
if char.isalnum():
a=ord(char)
b= a + 5
#if number wraps around, how to correct it
if
print(chr(c))
else:
print(chr(b))
else:
print(char)

Using str.translate:
In [24]: import string
In [25]: string.uppercase
Out[25]: 'ABCDEFGHIJKLMNOPQRSTUVWXYZ'
In [26]: string.uppercase[5:]+string.uppercase[:5]
Out[26]: 'FGHIJKLMNOPQRSTUVWXYZABCDE'
In [27]: table = string.maketrans(string.uppercase, string.uppercase[5:]+string.uppercase[:5])
In [28]: 'CAR'.translate(table)
Out[28]: 'HFW'
In [29]: 'HELLO'.translate(table)
Out[29]: 'MJQQT'

First, it matters if it is lower or upper case. I am going to assume here that all the characters are lower case (if they aren't, it would be easy enough to make them)
if b>122:
b=122-b #z=122
c=b+96 #a=97
w=119 in ASCII and z=122 (decimal in ASCII) so 119+5=124 and 124-122=2 which is our new b, then we add that to a-1 (this takes care of if we get a 1 back, 2+96=98 and 98 is b.
For the printing on the same line, instead of printing when you have them, I would write them to a list, then create a string from that list.
e.g instead of
print(chr(c))
else:
print(chr(b))
I would do
someList.append(chr(c))
else:
somList.append(chr(b))
then join each element of the list together into one string.

You could create a dictionary to handle it:
import string
s = string.lowercase + string.uppercase + string.digits + string.lowercase[:5]
encryptionKey = {s[i]:s[i+5] for i in range(len(s)-5)}
The final addend to s (+ string.lowercase[:5]) adds the first 5 letters into the key. Then, we use a simple dictionary comprehension to create a key for the encryption.
Put into your code (I also changed it so you iterate through the lines rather than using f.readline():
import string
def main():
fileName= input('Please enter the file name: ')
encryptFile(fileName)
def encryptFile(fileName):
s = string.lowercase + string.uppercase + string.digits + string.lowercase[:5]
encryptionKey = {s[i]:s[i+5] for i in range(len(s)-5)}
f= open(fileName, 'r')
line=1
for line in f:
for char in line:
if char.isalnum():
print(encryptionKey[char])
else:
print(char)