Related
Let's say we have a Python dictionary d, and we're iterating over it like so:
for k, v in d.iteritems():
del d[f(k)] # remove some item
d[g(k)] = v # add a new item
(f and g are just some black-box transformations.)
In other words, we try to add/remove items to d while iterating over it using iteritems.
Is this well defined? Could you provide some references to support your answer?
See also How to avoid "RuntimeError: dictionary changed size during iteration" error? for the separate question of how to avoid the problem.
Alex Martelli weighs in on this here.
It may not be safe to change the container (e.g. dict) while looping over the container.
So del d[f(k)] may not be safe. As you know, the workaround is to use d.copy().items() (to loop over an independent copy of the container) instead of d.iteritems() or d.items() (which use the same underlying container).
It is okay to modify the value at an existing index of the dict, but inserting values at new indices (e.g. d[g(k)] = v) may not work.
It is explicitly mentioned on the Python doc page (for Python 2.7) that
Using iteritems() while adding or deleting entries in the dictionary may raise a RuntimeError or fail to iterate over all entries.
Similarly for Python 3.
The same holds for iter(d), d.iterkeys() and d.itervalues(), and I'll go as far as saying that it does for for k, v in d.items(): (I can't remember exactly what for does, but I would not be surprised if the implementation called iter(d)).
You cannot do that, at least with d.iteritems(). I tried it, and Python fails with
RuntimeError: dictionary changed size during iteration
If you instead use d.items(), then it works.
In Python 3, d.items() is a view into the dictionary, like d.iteritems() in Python 2. To do this in Python 3, instead use d.copy().items(). This will similarly allow us to iterate over a copy of the dictionary in order to avoid modifying the data structure we are iterating over.
I have a large dictionary containing Numpy arrays, so the dict.copy().keys() thing suggested by #murgatroid99 was not feasible (though it worked). Instead, I just converted the keys_view to a list and it worked fine (in Python 3.4):
for item in list(dict_d.keys()):
temp = dict_d.pop(item)
dict_d['some_key'] = 1 # Some value
I realize this doesn't dive into the philosophical realm of Python's inner workings like the answers above, but it does provide a practical solution to the stated problem.
The following code shows that this is not well defined:
def f(x):
return x
def g(x):
return x+1
def h(x):
return x+10
try:
d = {1:"a", 2:"b", 3:"c"}
for k, v in d.iteritems():
del d[f(k)]
d[g(k)] = v+"x"
print d
except Exception as e:
print "Exception:", e
try:
d = {1:"a", 2:"b", 3:"c"}
for k, v in d.iteritems():
del d[f(k)]
d[h(k)] = v+"x"
print d
except Exception as e:
print "Exception:", e
The first example calls g(k), and throws an exception (dictionary changed size during iteration).
The second example calls h(k) and throws no exception, but outputs:
{21: 'axx', 22: 'bxx', 23: 'cxx'}
Which, looking at the code, seems wrong - I would have expected something like:
{11: 'ax', 12: 'bx', 13: 'cx'}
Python 3 you should just:
prefix = 'item_'
t = {'f1': 'ffw', 'f2': 'fca'}
t2 = dict()
for k,v in t.items():
t2[k] = prefix + v
or use:
t2 = t1.copy()
You should never modify original dictionary, it leads to confusion as well as potential bugs or RunTimeErrors. Unless you just append to the dictionary with new key names.
This question asks about using an iterator (and funny enough, that Python 2 .iteritems iterator is no longer supported in Python 3) to delete or add items, and it must have a No as its only right answer as you can find it in the accepted answer. Yet: most of the searchers try to find a solution, they will not care how this is done technically, be it an iterator or a recursion, and there is a solution for the problem:
You cannot loop-change a dict without using an additional (recursive) function.
This question should therefore be linked to a question that has a working solution:
How can I remove a key:value pair wherever the chosen key occurs in a deeply nested dictionary? (= "delete")
Also helpful as it shows how to change the items of a dict on the run: How can I replace a key:value pair by its value wherever the chosen key occurs in a deeply nested dictionary? (= "replace").
By the same recursive methods, you will also able to add items as the question asks for as well.
Since my request to link this question was declined, here is a copy of the solution that can delete items from a dict. See How can I remove a key:value pair wherever the chosen key occurs in a deeply nested dictionary? (= "delete") for examples / credits / notes.
import copy
def find_remove(this_dict, target_key, bln_overwrite_dict=False):
if not bln_overwrite_dict:
this_dict = copy.deepcopy(this_dict)
for key in this_dict:
# if the current value is a dict, dive into it
if isinstance(this_dict[key], dict):
if target_key in this_dict[key]:
this_dict[key].pop(target_key)
this_dict[key] = find_remove(this_dict[key], target_key)
return this_dict
dict_nested_new = find_remove(nested_dict, "sub_key2a")
The trick
The trick is to find out in advance whether a target_key is among the next children (= this_dict[key] = the values of the current dict iteration) before you reach the child level recursively. Only then you can still delete a key:value pair of the child level while iterating over a dictionary. Once you have reached the same level as the key to be deleted and then try to delete it from there, you would get the error:
RuntimeError: dictionary changed size during iteration
The recursive solution makes any change only on the next values' sub-level and therefore avoids the error.
I got the same problem and I used following procedure to solve this issue.
Python List can be iterate even if you modify during iterating over it.
so for following code it will print 1's infinitely.
for i in list:
list.append(1)
print 1
So using list and dict collaboratively you can solve this problem.
d_list=[]
d_dict = {}
for k in d_list:
if d_dict[k] is not -1:
d_dict[f(k)] = -1 # rather than deleting it mark it with -1 or other value to specify that it will be not considered further(deleted)
d_dict[g(k)] = v # add a new item
d_list.append(g(k))
Today I had a similar use-case, but instead of simply materializing the keys on the dictionary at the beginning of the loop, I wanted changes to the dict to affect the iteration of the dict, which was an ordered dict.
I ended up building the following routine, which can also be found in jaraco.itertools:
def _mutable_iter(dict):
"""
Iterate over items in the dict, yielding the first one, but allowing
it to be mutated during the process.
>>> d = dict(a=1)
>>> it = _mutable_iter(d)
>>> next(it)
('a', 1)
>>> d
{}
>>> d.update(b=2)
>>> list(it)
[('b', 2)]
"""
while dict:
prev_key = next(iter(dict))
yield prev_key, dict.pop(prev_key)
The docstring illustrates the usage. This function could be used in place of d.iteritems() above to have the desired effect.
[I had problem on how to iter through dict to find a pair of similar words and output it then the delete from dict]
My intention is to generate a random output label then store it into dictionary then iter through the dictionary and store the first key in the list or some sort then iter through the dictionary to search for similar key eg Light1on and Light1off has Light1 in it and get the value for both of the key to store into a table in its respective columns.
such as
Dict = {Light1on,Light2on,Light1off...}
store value equal to Light1on the iter through the dictionary to get eg Light1 off then store its Light1on:value1 and Light1off:value2 into a table or DF with columns name: On:value1 off:value2
As I dont know how to insert the code as code i can only provide the image sry for the trouble,its my first time asking question here thx.
from collections import defaultdict
import difflib, random
olist = []
input = 10
olist1 = ['Light1on','Light2on','Fan1on','Kettle1on','Heater1on']
olist2 = ['Light2off','Kettle1off','Light1off','Fan1off','Heater1off']
events = list(range(input + 1))
for i in range(len(olist1)):
output1 = random.choice(olist1)
print(output1,'1')
olist1.remove(output1)
output2 = random.choice(olist2)
print(output2,'2')
olist2.remove(output2)
olist.append(output1)
olist.append(output2)
print(olist,'3')
outputList = {olist[i]:events[i] for i in range(10)}
print (str(outputList),'4')
# Iterating through the keys finding a pair match
for s in range(5):
for i in outputList:
if i == list(outputList)[0]:
skeys = difflib.get_close_matches(i, outputList, n=2, cutoff=0.75)
print(skeys,'5')
del outputList[skeys]
# Modified Dictionary
difflib.get_close_matches('anlmal', ['car', 'animal', 'house', 'animaltion'])
['animal']
Updated: I was unable to delete the pair of similar from the list(Dictionary) after founding par in the dictionary
You're probably getting an error about a dictionary changing size during iteration. That's because you're deleting keys from a dictionary you're iterating over, and Python doesn't like that:
d = {1:2, 3:4}
for i in d:
del d[i]
That will throw:
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
RuntimeError: dictionary changed size during iteration
To work around that, one solution is to store a list of the keys you want to delete, then delete all those keys after you've finished iterating:
keys_to_delete = []
d = {1:2, 3:4}
for i in d:
if i%2 == 1:
keys_to_delete.append(i)
for i in keys_to_delete:
del d[i]
Ta-da! Same effect, but this way avoids the error.
Also, your code above doesn't call the difflib.get_close_matches function properly. You can use print(help(difflib.get_close_matches)) to see how you are meant to call that function. You need to provide a second argument that indicates the items to which you wish to compare your first argument for possible matches.
All of that said, I have a feeling that you can accomplish your fundamental goals much more simply. If you spend a few minutes describing what you're really trying to do (this shouldn't involve any references to data types, it should just involve a description of your data and your goals), then I bet someone on this site can help you solve that problem much more simply!
Let's say we have a Python dictionary d, and we're iterating over it like so:
for k, v in d.iteritems():
del d[f(k)] # remove some item
d[g(k)] = v # add a new item
(f and g are just some black-box transformations.)
In other words, we try to add/remove items to d while iterating over it using iteritems.
Is this well defined? Could you provide some references to support your answer?
See also How to avoid "RuntimeError: dictionary changed size during iteration" error? for the separate question of how to avoid the problem.
Alex Martelli weighs in on this here.
It may not be safe to change the container (e.g. dict) while looping over the container.
So del d[f(k)] may not be safe. As you know, the workaround is to use d.copy().items() (to loop over an independent copy of the container) instead of d.iteritems() or d.items() (which use the same underlying container).
It is okay to modify the value at an existing index of the dict, but inserting values at new indices (e.g. d[g(k)] = v) may not work.
It is explicitly mentioned on the Python doc page (for Python 2.7) that
Using iteritems() while adding or deleting entries in the dictionary may raise a RuntimeError or fail to iterate over all entries.
Similarly for Python 3.
The same holds for iter(d), d.iterkeys() and d.itervalues(), and I'll go as far as saying that it does for for k, v in d.items(): (I can't remember exactly what for does, but I would not be surprised if the implementation called iter(d)).
You cannot do that, at least with d.iteritems(). I tried it, and Python fails with
RuntimeError: dictionary changed size during iteration
If you instead use d.items(), then it works.
In Python 3, d.items() is a view into the dictionary, like d.iteritems() in Python 2. To do this in Python 3, instead use d.copy().items(). This will similarly allow us to iterate over a copy of the dictionary in order to avoid modifying the data structure we are iterating over.
I have a large dictionary containing Numpy arrays, so the dict.copy().keys() thing suggested by #murgatroid99 was not feasible (though it worked). Instead, I just converted the keys_view to a list and it worked fine (in Python 3.4):
for item in list(dict_d.keys()):
temp = dict_d.pop(item)
dict_d['some_key'] = 1 # Some value
I realize this doesn't dive into the philosophical realm of Python's inner workings like the answers above, but it does provide a practical solution to the stated problem.
The following code shows that this is not well defined:
def f(x):
return x
def g(x):
return x+1
def h(x):
return x+10
try:
d = {1:"a", 2:"b", 3:"c"}
for k, v in d.iteritems():
del d[f(k)]
d[g(k)] = v+"x"
print d
except Exception as e:
print "Exception:", e
try:
d = {1:"a", 2:"b", 3:"c"}
for k, v in d.iteritems():
del d[f(k)]
d[h(k)] = v+"x"
print d
except Exception as e:
print "Exception:", e
The first example calls g(k), and throws an exception (dictionary changed size during iteration).
The second example calls h(k) and throws no exception, but outputs:
{21: 'axx', 22: 'bxx', 23: 'cxx'}
Which, looking at the code, seems wrong - I would have expected something like:
{11: 'ax', 12: 'bx', 13: 'cx'}
Python 3 you should just:
prefix = 'item_'
t = {'f1': 'ffw', 'f2': 'fca'}
t2 = dict()
for k,v in t.items():
t2[k] = prefix + v
or use:
t2 = t1.copy()
You should never modify original dictionary, it leads to confusion as well as potential bugs or RunTimeErrors. Unless you just append to the dictionary with new key names.
This question asks about using an iterator (and funny enough, that Python 2 .iteritems iterator is no longer supported in Python 3) to delete or add items, and it must have a No as its only right answer as you can find it in the accepted answer. Yet: most of the searchers try to find a solution, they will not care how this is done technically, be it an iterator or a recursion, and there is a solution for the problem:
You cannot loop-change a dict without using an additional (recursive) function.
This question should therefore be linked to a question that has a working solution:
How can I remove a key:value pair wherever the chosen key occurs in a deeply nested dictionary? (= "delete")
Also helpful as it shows how to change the items of a dict on the run: How can I replace a key:value pair by its value wherever the chosen key occurs in a deeply nested dictionary? (= "replace").
By the same recursive methods, you will also able to add items as the question asks for as well.
Since my request to link this question was declined, here is a copy of the solution that can delete items from a dict. See How can I remove a key:value pair wherever the chosen key occurs in a deeply nested dictionary? (= "delete") for examples / credits / notes.
import copy
def find_remove(this_dict, target_key, bln_overwrite_dict=False):
if not bln_overwrite_dict:
this_dict = copy.deepcopy(this_dict)
for key in this_dict:
# if the current value is a dict, dive into it
if isinstance(this_dict[key], dict):
if target_key in this_dict[key]:
this_dict[key].pop(target_key)
this_dict[key] = find_remove(this_dict[key], target_key)
return this_dict
dict_nested_new = find_remove(nested_dict, "sub_key2a")
The trick
The trick is to find out in advance whether a target_key is among the next children (= this_dict[key] = the values of the current dict iteration) before you reach the child level recursively. Only then you can still delete a key:value pair of the child level while iterating over a dictionary. Once you have reached the same level as the key to be deleted and then try to delete it from there, you would get the error:
RuntimeError: dictionary changed size during iteration
The recursive solution makes any change only on the next values' sub-level and therefore avoids the error.
I got the same problem and I used following procedure to solve this issue.
Python List can be iterate even if you modify during iterating over it.
so for following code it will print 1's infinitely.
for i in list:
list.append(1)
print 1
So using list and dict collaboratively you can solve this problem.
d_list=[]
d_dict = {}
for k in d_list:
if d_dict[k] is not -1:
d_dict[f(k)] = -1 # rather than deleting it mark it with -1 or other value to specify that it will be not considered further(deleted)
d_dict[g(k)] = v # add a new item
d_list.append(g(k))
Today I had a similar use-case, but instead of simply materializing the keys on the dictionary at the beginning of the loop, I wanted changes to the dict to affect the iteration of the dict, which was an ordered dict.
I ended up building the following routine, which can also be found in jaraco.itertools:
def _mutable_iter(dict):
"""
Iterate over items in the dict, yielding the first one, but allowing
it to be mutated during the process.
>>> d = dict(a=1)
>>> it = _mutable_iter(d)
>>> next(it)
('a', 1)
>>> d
{}
>>> d.update(b=2)
>>> list(it)
[('b', 2)]
"""
while dict:
prev_key = next(iter(dict))
yield prev_key, dict.pop(prev_key)
The docstring illustrates the usage. This function could be used in place of d.iteritems() above to have the desired effect.
I am new to python and really programming in general and am learning python through a website called rosalind.info, which is a website that aims to teach through problem solving.
Here is the problem, wherein you're asked to calculate the percentage of guanine and thymine to the string of DNA given to for each ID, then return the ID of the sample with the greatest percentage.
I'm working on the sample problem on the page and am experiencing some difficulty. I know my code is probably really inefficient and cumbersome but I take it that's to be expected for those who are new to programming.
Anyway, here is my code.
gc = open("rosalind_gcsamp.txt","r")
biz = gc.readlines()
i = 0
gcc = 0
d = {}
for i in xrange(biz.__len__()):
if biz[i].startswith(">"):
biz[i] = biz[i].replace("\n","")
biz[i+1] = biz[i+1].replace("\n","") + biz[i+2].replace("\n","")
del biz[i+2]
What I'm trying to accomplish here is, given input such as this:
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
Break what's given into a list based on the lines and concatenate the two lines of DNA like so:
['>Rosalind_6404', 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG', 'TCCCACTAATAATTCTGAGG\n']
And delete the entry two indices after the ID, which is >Rosalind. What I do with it later I still need to figure out.
However, I keep getting an index error and can't, for the life of me, figure out why. I'm sure it's a trivial reason, I just need some help.
I've even attempted the following to limited success:
for i in xrange(biz.__len__()):
if biz[i].startswith(">"):
biz[i] = biz[i].replace("\n","")
biz[i+1] = biz[i+1].replace("\n","") + biz[i+2].replace("\n","")
elif biz[i].startswith("A" or "C" or "G" or "T") and biz[i+1].startswith(">"):
del biz[i]
which still gives me an index error but at least gives me the biz value I want.
Thanks in advance.
It is very easy do with itertools.groupby using lines that start with > as the keys and as the delimiters:
from itertools import groupby
with open("rosalind_gcsamp.txt","r") as gc:
# group elements using lines that start with ">" as the delimiter
groups = groupby(gc, key=lambda x: not x.startswith(">"))
d = {}
for k,v in groups:
# if k is False we a non match to our not x.startswith(">")
# so use the value v as the key and call next on the grouper object
# to get the next value
if not k:
key, val = list(v)[0].rstrip(), "".join(map(str.rstrip,next(groups)[1],""))
d[key] = val
print(d)
{'>Rosalind_0808': 'CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT', '>Rosalind_5959': 'CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCTATATCCATTTGTCAGCAGACACGC', '>Rosalind_6404': 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG'}
If you need order use a collections.OrderedDict in place of d.
You are looping over the length of biz. So in your last iteration biz[i+1] and biz[i+2] don't exist. There is no item after the last.
i ran into a little logic problem and trying to figure it out.
my case is as follows:
i have a list of items each item represents a Group
i need to create a set of nested groups,
so, for example:
myGroups = ["head", "neck", "arms", "legs"]
i need to get them to be represented like this:
(if you can imaging a folder structure)
head
|_> neck
|_> arms
|_>legs
and so on until i hit the last element.
what i thought would work (but don't know really how to advance here) is:
def createVNTgroups(self, groupsData):
for i in range(len(groupsData)):
print groupsData[i]
for q in range(1, len(groupsData)):
print groupsData[q]
but in this case, i am running over same elements in 'i' that i already took with 'q'.
could someone give me a hint?
thanks in advance!
If I understood well, you want a nested structure. For this case, you can use a recursive function:
myGroups = ["head", "neck", "arms", "legs"]
def createVNTgroups(alist):
temp = alist[:] # needed because lists are mutable
first = [temp.pop(0)] # extract first element from list
if temp: # if the list still contains more items,
second = [createVNTgroups(temp)] # do it recursively
return first + second # returning the second object attached to the first.
else: # Otherwise,
return first # return the last element
print createVNTgroups(myGroups)
this produces a nested list:
['head', ['neck', ['arms', ['legs']]]]
Is that what you were looking for?
>>> m
['head', 'neck', 'arms', 'legs']
>>> reduce(lambda x,y:[x,y][::-1] if x!=y else [x], m[::-1],m[-1])
['head', ['neck', ['arms', ['legs']]]]