Python difference between sets not working - python

I am working on a web-scraping project. As the code runs, first is saved a list of around 100 products. The links are saved into one list called current_products.
Then after some time this is done again but saved into other list called new_products. Then I compare if they are the same (no new products listed on the website) or the new_products list is different from the current_items list and there was item added. I have the following code:
if (new_products == current_products):
print("No new items found. Trying again in 5 seconds...")
new_products = []
else:
print("New products found")
products_new = set(new_products) - set(current_products)
print(products_new)
As a testing data i put a duplicate link into the new_items. The code prints that the lists are different but then doesnt print any new product link (the difference between these lists) just empty set ({}). Any idea how to fix it?
EDIT: It doesnt work with DUPLICATE test data. When i put brand new link (that is not in either list) it works perfectly. Is there a way how to IGNORE duplicates?

Here is a trivial example of how this could be happening:
>>> a = [1, 2]
>>> b = [2, 1]
>>> a == b
False
>>> set(a) - set(b)
set()
To avoid this, either sort the lists before comparing them, or just compare sets to start with:
ds = set(a) - set(b)
if ds:
print('diffs')
else:
print('no diffs')
Making a set is more efficient for large data than sorting because it's an O(n) operation vs O(n log n) for sorting.

I think a more efficient code would be
products_new = set(new_products) - set(current_products)
if (len(products_new) == 0):
print("No new items found. Trying again in 5 seconds...")
new_products = []
else:
print("New products found")
print(products_new)

Related

CS50 'DNA': Ways to speed up my Week 6 'dna.py' program?

So for this problem I had to create a program that takes in two arguments. A CSV database like this:
name,AGATC,AATG,TATC
Alice,2,8,3
Bob,4,1,5
Charlie,3,2,5
And a DNA sequence like this:
TAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG
My program works by first getting the "Short Tandem Repeat" (STR) headers from the database (AGATC, etc.), then counting the highest number of times each STR repeats consecutively within the sequence. Finally, it compares these counted values to the values of each row in the database, printing out a name if a match is found, or "No match" otherwise.
The program works for sure, but is ridiculously slow whenever ran using the larger database provided, to the point where the terminal pauses for an entire minute before returning any output. And unfortunately this is causing the 'check50' marking system to time-out and return a negative result upon testing with this large database.
I'm presuming the slowdown is caused by the nested loops within the 'STR_count' function:
def STR_count(sequence, seq_len, STR_array, STR_array_len):
# Creates a list to store max recurrence values for each STR
STR_count_values = [0] * STR_array_len
# Temp value to store current count of STR recurrence
temp_value = 0
# Iterates over each STR in STR_array
for i in range(STR_array_len):
STR_len = len(STR_array[i])
# Iterates over each sequence element
for j in range(seq_len):
# Ensures it's still physically possible for STR to be present in sequence
while (seq_len - j >= STR_len):
# Gets sequence substring of length STR_len, starting from jth element
sub = sequence[j:(j + (STR_len))]
# Compares current substring to current STR
if (sub == STR_array[i]):
temp_value += 1
j += STR_len
else:
# Ensures current STR_count_value is highest
if (temp_value > STR_count_values[i]):
STR_count_values[i] = temp_value
# Resets temp_value to break count, and pushes j forward by 1
temp_value = 0
j += 1
i += 1
return STR_count_values
And the 'DNA_match' function:
# Searches database file for DNA matches
def DNA_match(STR_values, arg_database, STR_array_len):
with open(arg_database, 'r') as csv_database:
database = csv.reader(csv_database)
name_array = [] * (STR_array_len + 1)
next(database)
# Iterates over one row of database at a time
for row in database:
name_array.clear()
# Copies entire row into name_array list
for column in row:
name_array.append(column)
# Converts name_array number strings to actual ints
for i in range(STR_array_len):
name_array[i + 1] = int(name_array[i + 1])
# Checks if a row's STR values match the sequence's values, prints the row name if match is found
match = 0
for i in range(0, STR_array_len, + 1):
if (name_array[i + 1] == STR_values[i]):
match += 1
if (match == STR_array_len):
print(name_array[0])
exit()
print("No match")
exit()
However, I'm new to Python, and haven't really had to consider speed before, so I'm not sure how to improve upon this.
I'm not particularly looking for people to do my work for me, so I'm happy for any suggestions to be as vague as possible. And honestly, I'll value any feedback, including stylistic advice, as I can only imagine how disgusting this code looks to those more experienced.
Here's a link to the full program, if helpful.
Thanks :) x
Thanks for providing a link to the entire program. It seems needlessly complex, but I'd say it's just a lack of knowing what features are available to you. I think you've already identified the part of your code that's causing the slowness - I haven't profiled it or anything, but my first impulse would also be the three nested loops in STR_count.
Here's how I would write it, taking advantage of the Python standard library. Every entry in the database corresponds to one person, so that's what I'm calling them. people is a list of dictionaries, where each dictionary represents one line in the database. We get this for free by using csv.DictReader.
To find the matches in the sequence, for every short tandem repeat in the database, we create a regex pattern (the current short tandem repeat, repeated one or more times). If there is a match in the sequence, the total number of repetitions is equal to the length of the match divided by the length of the current tandem repeat. For example, if AGATCAGATCAGATC is present in the sequence, and the current tandem repeat is AGATC, then the number of repetitions will be len("AGATCAGATCAGATC") // len("AGATC") which is 15 // 5, which is 3.
count is just a dictionary that maps short tandem repeats to their corresponding number of repetitions in the sequence. Finally, we search for a person whose short tandem repeat counts match those of count exactly, and print their name. If no such person exists, we print "No match".
def main():
import argparse
from csv import DictReader
import re
parser = argparse.ArgumentParser()
parser.add_argument("database_filename")
parser.add_argument("sequence_filename")
args = parser.parse_args()
with open(args.database_filename, "r") as file:
reader = DictReader(file)
short_tandem_repeats = reader.fieldnames[1:]
people = list(reader)
with open(args.sequence_filename, "r") as file:
sequence = file.read().strip()
count = dict(zip(short_tandem_repeats, [0] * len(short_tandem_repeats)))
for short_tandem_repeat in short_tandem_repeats:
pattern = f"({short_tandem_repeat}){{1,}}"
match = re.search(pattern, sequence)
if match is None:
continue
count[short_tandem_repeat] = len(match.group()) // len(short_tandem_repeat)
try:
person = next(person for person in people if all(int(person[k]) == count[k] for k in short_tandem_repeats))
print(person["name"])
except StopIteration:
print("No match")
return 0
if __name__ == "__main__":
import sys
sys.exit(main())

Slow list parsing with python3.7 for duplicate item removal

I'm trying to remove duplicate items from a large text file containing 250 million items at 4.4 Gigabytes.
I was impressed to see that I could load this file into a python list in just a few minutes with the following code:
x = []
with open("online.txt") as file:
for l in file:
x.append(l)
print('count of array: ')
print(len(x))
But when I tried to simply check to make sure the next item doesn't exist before added it to an array, it's taking many hours to finish. I feel like I'm missing something simple that would really speed this up.
Here's the code I used to check for duplicate items:
a = []
x = []
with open("online.txt") as file:
for l in file:
if l in a:
print('duplicate')
print(l)
else:
x.append(l.strip())
a.append(l)
print('with duplicates: ');
print(len(a))
print('without duplicates: ')
print(len(x))
This is running on a server with 64 Gigs of ram and modern dual xeon processors.
The problem is with a simple list, python has to search through every entry each time before adding a new one.
You could try a python dictionary or a set instead of a list. These data structures are faster for determining if an entry exists already.
Simply change your code:
a = {} # set
x = {}
with open("online.txt") as file:
for l in file:
if l in a:
print('duplicate')
print(l)
else:
x.add(l.strip()) # add to the set
a.add(l)
You don't specify your input file-format, but there may be speed increases possibly by loading the whole data-set into a giant string, then splitting it up with python functions, rather than manually like you do here.
In the end, here's the code I used to remove duplicates:
x = set([])
with open("all.txt") as file:
for l in file:
x.add(l)
print('count of array: ')
print(len(x))

Storing Multi-dimensional Lists?

(Code below)
I'm scraping a website and the data I'm getting back is in 2 multi-dimensional arrays. I'm wanting everything to be in a JSON format because I want to save this and load it in again later when I add "tags".
So, less vague. I'm writing a program which takes in data like what characters you have and what missions are requiring you to do (you can complete multiple at once if the attributes align), and then checks that against a list of attributes that each character fulfills and returns a sorted list of the best characters for the context.
Right now I'm only scraping character data but I've already "got" the attribute data per character - the problem there was that it wasn't sorted by name so it was just a randomly repeating list that I needed to be able to look up. I still haven't quite figured out how to do that one.
Right now I have 2 arrays, 1 for the headers of the table and one for the rows of the table. The rows contain the "Answers" for the Header's "Questions" / "Titles" ; ie Maximum Level, 50
This is true for everything but the first entry which is the Name, Pronunciation (and I just want to store the name of course).
So:
Iterations = 0
While loop based on RowArray length / 9 (While Iterations <= that)
HeaderArray[0] gives me the name
RowArray[Iterations + 1] gives me data type 2
RowArray[Iterations + 2] gives me data type 3
Repeat until Array[Iterations + 8]
Iterations +=9
So I'm going through and appending these to separate lists - single arrays like CharName[] and CharMaxLevel[] and so on.
But I'm actually not sure if that's going to make this easier or not? Because my end goal here is to send "CharacterName" and get stuff back based on that AND be able to send in "DesiredTraits" and get "CharacterNames who fit that trait" back. Which means I also need to figure out how to store that category data semi-efficiently. There's over 80 possible categories and most only fit into about 10. I don't know how I'm going to store or load that data.
I'm assuming JSON is the best way? And I'm trying to keep it all in one file for performance and code readability reasons - don't want a file for each character.
CODE: (Forgive me, I've never scraped anything before + I'm actually somewhat new to Python - just got it 4? days ago)
https://pastebin.com/yh3Z535h
^ In the event anyone wants to run this and this somehow makes it easier to grab the raw code (:
import time
import requests, bs4, re
from urllib.parse import urljoin
import json
import os
target_dir = r"D:\00Coding\Js\WebScraper" #Yes, I do know that storing this in my Javascript folder is filthy
fullname = os.path.join(target_dir,'TsumData.txt')
StartURL = 'http://disneytsumtsum.wikia.com/wiki/Skill_Upgrade_Chart'
URLPrefix = 'http://disneytsumtsum.wikia.com'
def make_soup(url):
r = requests.get(url)
soup = bs4.BeautifulSoup(r.text, 'lxml')
return soup
def get_links(url):
soup = make_soup(url)
a_tags = soup.find_all('a', href=re.compile(r"^/wiki/"))
links = [urljoin(URLPrefix, a['href'])for a in a_tags] # convert relative url to absolute url
return links
def get_tds(link):
soup = make_soup(link)
#tds = soup.find_all('li', class_="category normal") #This will give me the attributes / tags of each character
tds = soup.find_all('table', class_="wikia-infobox")
RowArray = []
HeaderArray = []
if tds:
for td in tds:
#print(td.text.strip()) #This is everything
rows = td.findChildren('tr')#[0]
headers = td.findChildren('th')#[0]
for row in rows:
cells = row.findChildren('td')
for cell in cells:
cell_content = cell.getText()
clean_content = re.sub( '\s+', ' ', cell_content).strip()
if clean_content:
RowArray.append(clean_content)
for row in rows:
cells = row.findChildren('th')
for cell in cells:
cell_content = cell.getText()
clean_content = re.sub( '\s+', ' ', cell_content).strip()
if clean_content:
HeaderArray.append(clean_content)
print(HeaderArray)
print(RowArray)
return(RowArray, HeaderArray)
#Output = json.dumps([dict(zip(RowArray, row_2)) for row_2 in HeaderArray], indent=1)
#print(json.dumps([dict(zip(RowArray, row_2)) for row_2 in HeaderArray], indent=1))
#TempFile = open(fullname, 'w') #Read only, Write Only, Append
#TempFile.write("EHLLO")
#TempFile.close()
#print(td.tbody.Series)
#print(td.tbody[Series])
#print(td.tbody["Series"])
#print(td.data-name)
#time.sleep(1)
if __name__ == '__main__':
links = get_links(StartURL)
MainHeaderArray = []
MainRowArray = []
MaxIterations = 60
Iterations = 0
for link in links: #Specifically I'll need to return and append the arrays here because they're being cleared repeatedly.
#print("Getting tds calling")
if Iterations > 38: #There are this many webpages it'll first look at that don't have the data I need
TempRA, TempHA = get_tds(link)
MainHeaderArray.append(TempHA)
MainRowArray.append(TempRA)
MaxIterations -= 1
Iterations += 1
#print(MaxIterations)
if MaxIterations <= 0: #I don't want to scrape the entire website for a prototype
break
#print("This is the end ??")
#time.sleep(3)
#jsonized = map(lambda item: {'Name':item[0], 'Series':item[1]}, zip())
print(MainHeaderArray)
#time.sleep(2.5)
#print(MainRowArray)
#time.sleep(2.5)
#print(zip())
TsumName = []
TsumSeries = []
TsumBoxType = []
TsumSkillDescription = []
TsumFullCharge = []
TsumMinScore = []
TsumScoreIncreasePerLevel = []
TsumMaxScore = []
TsumFullUpgrade = []
Iterations = 0
MaxIterations = len(MainRowArray)
while Iterations <= MaxIterations: #This will fire 1 time per Tsum
print(Iterations)
print(MainHeaderArray[Iterations][0]) #Holy this gives us Mickey ;
print(MainHeaderArray[Iterations+1][0])
print(MainHeaderArray[Iterations+2][0])
print(MainHeaderArray[Iterations+3][0])
TsumName.append(MainHeaderArray[Iterations][0])
print(MainRowArray[Iterations][1])
#At this point it will, of course, crash - that's because I only just realized I needed to append AND I just realized that everything
#Isn't stored in a list as I thought, but rather a multi-dimensional array (as you can see below I didn't know this)
TsumSeries[Iterations] = MainRowArray[Iterations+1]
TsumBoxType[Iterations] = MainRowArray[Iterations+2]
TsumSkillDescription[Iterations] = MainRowArray[Iterations+3]
TsumFullCharge[Iterations] = MainRowArray[Iterations+4]
TsumMinScore[Iterations] = MainRowArray[Iterations+5]
TsumScoreIncreasePerLevel[Iterations] = MainRowArray[Iterations+6]
TsumMaxScore[Iterations] = MainRowArray[Iterations+7]
TsumFullUpgrade[Iterations] = MainRowArray[Iterations+8]
Iterations += 9
print(Iterations)
print("It's Over")
time.sleep(3)
print(TsumName)
print(TsumSkillDescription)
Edit:
tl;dr my goal here is to be like
"For this Mission Card I need a Blue Tsum with high score potential, a Monster's Inc Tsum for a bunch of games, and a Male Tsum for a long chain.. what's the best Tsum given those?" and it'll be like "SULLY!" and automatically select it or at the very least give you a list of Tsums. Like "These ones match all of them, these ones match 2, and these match 1"
Edit 2:
Here's the command Line Output for the code above:
https://pastebin.com/vpRsX8ni
Edit 3: Alright, just got back for a short break. With some minor looking over I see what happened - my append code is saying "Append this list to the array" meaning I've got a list of lists for both the Header and Row arrays that I'm storing. So I can confirm (for myself at least) that these aren't nested lists per se but they are definitely 2 lists, each containing a single list at every entry. Definitely not a dictionary or anything "special case" at least. This should help me quickly find an answer now that I'm not throwing "multi-dimensional list" around my google searches or wondering why the list stuff isn't working (as it's expecting 1 value and gets a list instead).
Edit 4:
I need to simply add another list! But super nested.
It'll just store the categories that the Tsum has as a string.
so Array[10] = ArrayOfCategories[Tsum] (which contains every attribute in string form that the Tsum has)
So that'll be ie TsumArray[10] = ["Black", "White Gloves", "Mickey & Friends"]
And then I can just use the "Switch" that I've already made in order to check them. Possibly. Not feeling too well and haven't gotten that far yet.
Just use the with open file as json_file , write/read (super easy).
Ultimately stored 3 json files. No big deal. Much easier than appending into one big file.

Compare two lists in python and obtain non-equality

This piece of code in theory have to compare two lists which have the ID of a tweet, and in this comparison if it already exists in screen printing , otherwise not.
But I print all or not being listed.
Any suggestions to compare these two lists of ID's and if not the ID of the first list in the second then print it ?
Sorry for the little efficient code . ( and my English )
What I seek is actually not do RT ( retweet ) repeatedly when I already have . I use Tweepy library , I read the timeline , and make the tweet RT I did not do RT
def analizarRT():
timeline = []
temp = []
RT = []
fileRT = openFile('rt.txt')
for status in api.user_timeline('cnn', count='6'):
timeline.append(status)
for i in range(6):
temp.append(timeline[i].id)
for a in range(6):
for b in range(6):
if str(temp[a]) == fileRT[b]:
pass
else:
RT.append(temp[a])
for i in RT:
print i
Solved add this function !
def estaElemento(tweetId, arreglo):
encontrado = False
for a in range(len(arreglo)):
if str(tweetId) == arreglo[a].strip():
encontrado = True
break
return encontrado
Its a simple program, don't complicate it. As per your comments, there are two lists:)
1. timeline
2. fileRT
Now, you want to compare the id's in both these lists. Before you do that, you must know the nature of these two lists.
I mean, what is the type of data in the lists?
Is it
list of strings? or
list of objects? or
list of integers?
So, find out that, debug it, or use print statements in your code. Or please add these details in your question. So, you can give a perfect answer.
Mean while, try this:
if timeline.id == fileRT.id should work.
Edited:
def analizarRT():
timeline = []
fileRT = openFile('rt.txt')
for status in api.user_timeline('cnn', count='6'):
timeline.append(status)
for i in range(6):
for b in range(6):
if timeline[i].id == fileRT[b].id:
pass
else:
newlist.append(timeline[i].id)
print newlist
As per your question, you want to obtain them, right?. I have appended them in a newlist. Now you can say print newlist to see the items
your else statement is associated with the for statement, you probably need to add one more indent to make it work on the if statement.

Python: How to speed up creating of objects?

I'm creating objects derived from a rather large txt file. My code is working properly but takes a long time to run. This is because the elements I'm looking for in the first place are not ordered and not (necessarily) unique. For example I am looking for a digit-code that might be used twice in the file but could be in the first and the last row. My idea was to check how often a certain code is used...
counter=collections.Counter([l[3] for l in self.body])
...and then loop through the counter. Advance: if a code is only used once you don't have to iterate over the whole file. However You are stuck with a lot of iterations which makes the process really slow.
So my question really is: how can I improve my code? Another idea of course is to oder the data first. But that could take quite long as well.
The crucial part is this method:
def get_pc(self):
counter=collections.Counter([l[3] for l in self.body])
# This returns something like this {'187':'2', '199':'1',...}
pcode = []
#loop through entries of counter
for k,v in counter.iteritems():
i = 0
#find post code in body
for l in self.body:
if i == v:
break
# find fist appearence of key
if l[3] == k:
#first encounter...
if i == 0:
#...so create object
self.pc = CodeCana(k,l[2])
pcode.append(self.pc)
i += 1
# make attributes
self.pc.attr((l[0],l[1]),l[4])
if v <= 1:
break
return pcode
I hope the code explains the problem sufficiently. If not, let me know and I will expand the provided information.
You are looping over body way too many times. Collapse this into one loop, and track the CodeCana items in a dictionary instead:
def get_pc(self):
pcs = dict()
pcode = []
for l in self.body:
pc = pcs.get(l[3])
if pc is None:
pc = pcs[l[3]] = CodeCana(l[3], l[2])
pcode.append(pc)
pc.attr((l[0],l[1]),l[4])
return pcode
Counting all items first then trying to limit looping over body by that many times while still looping over all the different types of items defeats the purpose somewhat...
You may want to consider giving the various indices in l names. You can use tuple unpacking:
for foo, bar, baz, egg, ham in self.body:
pc = pcs.get(egg)
if pc is None:
pc = pcs[egg] = CodeCana(egg, baz)
pcode.append(pc)
pc.attr((foo, bar), ham)
but building body out of a namedtuple-based class would help in code documentation and debugging even more.

Categories

Resources