Develop Reference

How do I fix infinite loop bugs in Python?

I have a problem regarding a competition question I'm attempting to do. Here is the question (its a bit long)
""""
Welcome aboard, Captain! Today you are in charge of the first ever doughnut-shaped spaceship, The
Circular. There are N cabins arranged in a circle on the spaceship. They are numbered from 1 to N in
a clockwise direction around the ship. The ith and the (i + 1)th cabins are connected. So too are cabin
1 and cabin N.
Currently the ith cabin has Ai crewmates, however the spaceship cannot depart unless there are exactly
Bi crewmates in this cabin.
To achieve this, you have the power to pay crewmates to change cabins. You can pay a crewmate $1 to
move to an adjacent cabin. A crewmate can be asked to move multiple times, provided that you pay
them $1 each time.
What is the fewest dollars you must pay before you can depart? It is always be possible to depart.
""""
https://orac2.info/problem/aio22spaceship/ (the link to the intereactive Qs)
I searched the web and i found no solutions to the Q. My code seems to be infinite looping i guess but im not sure as i cant see what cases the sit uses to determine if my code is right.
Heres my code
#!/usr/bin/env python
import sys
sys.setrecursionlimit(1000000000)
#
# Solution Template for Spaceship Shuffle
#
# Australian Informatics Olympiad 2022
#
# This file is provided to assist with reading and writing of the input
# files for the problem. You may modify this file however you wish, or
# you may choose not to use this file at all.
#
# N is the number of cabins.
N = None
# A contains the initial number of crewmates in each cabin. Note that here the
# cabins are numbered starting from 0.
A = []
# B contains the desired number of crewmates in each cabin. Note that here the
# cabins are numbered starting from 0.
B = []
answer = 0
# Open the input and output files.
input_file = open("spacein.txt", "r")
output_file = open("spaceout.txt", "w")
# Read the value of N.
N = int(input_file.readline().strip())
# Read the values of A and B.
input_line = input_file.readline().strip()
A = list(map(int, input_line.split()))
input_line = input_file.readline().strip()
B = list(map(int, input_line.split()))
AM = A
#AM is my modifying set
# TODO: This is where you should compute your solution. Store the fewest
# dollars you must pay before you can depart into the variable
while AM != B:
#Check if the set is correct
#notfound is a testing variable to see if my code was looping due to input error
notfound = True
for i in range(N):
#Check which places needs people to be moved
while AM[i]>B[i]:
notfound = False
#RV and LV check the "neediness" for each half's people requirements. I check how many people
#are needed on one side compared to the other and subtract the "overflow of people"
RV = 0
LV = 0
for j in range(int(N/2-0.5)):
#The range thing makes sure that if N is odd, im splitting the middle but if N is even, i leave out the end pod
RV += B[(i+j+1)%N]-AM[(i+j+1)%N]
LV += B[(i-j-1)%N]-AM[(i-j-1)%N]
answer +=1
if RV>LV:
AM[i]+=-1
AM[(i+1)%N]+=1
else:
AM[i]+=-1
AM[(i-1)%N]+=1
print(AM,B)
if notfound:
break
print(answer)
# Write the answer to the output file.
output_file.write("%d\n" % (answer))
# Finally, close the input/output files.
input_file.close()
output_file.close()
please help i really neeed to know the answer, driving me mad ngl
Welp, there aren't any resources online and I've tried everything. I think the problem might be that because of my solving method, passengers may be flicked between two pods indefinitely. Not sure since i could make a case that demoed this.
also my post probably is messy since this is my first time posting

UnboundLocalError: local variable date referenced before assignment

I have a file here that asks the user for a city/county, reads the file to find any lines with the city or county they specified, and in the end the program should print the date that the number of increase in cases was highest.
def main():
#open the file
myFile = open("Covid Data.txt")
#read the first line
firstLine = myFile.readline()
#set current, previous, and greatest to 0
current = 0
previous = 0
greatest = 0
#ask user for a city/county name
userLocation = input("Please enter a location ").title
#for each line in the file
for dataLine in myFile:
#strip the end of the line
dataLine = dataLine.rstrip("\n")
#split the data line by the commas and place the parts into a list
dataList = dataLine.split(",")
#if dataList[2] is equal to location
if dataList[2] == userLocation:
#subtract previous from current to find the number of cases that the total increased by
cases = current - previous
#if cases is higher than what is currently set as the greatest
if cases > greatest:
#set the new greatest to amount of cases
greatest = cases
#save the date of the current line
date = str(dataList[0])
#At the end print the data for the highest number of cases
print("On",date," ",location," had the highest increase of cases with ",cases," cases.")
#close file
For some reason, every time I run the code, after I type in what city/county I want to view information for, I keep getting an UnboundLocalError for the variable "date". It tells me that it was referenced before assignment, even though I clearly define it. Why am I getting this error?

You will need to initialize a value for the date variable before entering the loop. For example date = None. Same with cases. The problem is that if there is no valid data available, the date in the loop never gets set and thus doesn't exist.
You also are not altering the values of current or previous, which might be the cause for the bug you're seeing where the date variable never gets set (cases will always get value 0 in the loop).
Also there is a typo in the print, where you try to use location instead of the actual variable called userLocation.

My friend, you are having the problem of locals() and globals() attribute.
I am quite sure, If you put:
globals()[date]= str(dataList[0])
you won't have this problem anymore. Check this page, in 5 minutes you will understand:
https://www.geeksforgeeks.org/global-local-variables-python/

Your code has more defects.
The title is a method so you have to use as .title().
You have to define your variables outside of conditions.
The location variable is undefined in your print function.
I have written a working version from your code.
Code:
def main():
# open the file
myFile = open("Covid Data.txt")
# read the first line
firstLine = myFile.readline()
# set current, previous, and greatest to 0
current = 0
previous = 0
greatest = 0
cases = 0
date = None
# ask user for a city/county name
userLocation = input("Please enter a location ").title()
# for each line in the file
for dataLine in myFile:
# strip the end of the line
dataLine = dataLine.rstrip("\n")
# split the data line by the commas and place the parts into a list
dataList = dataLine.split(",")
print(dataList)
# if dataList[2] is equal to location
if dataList[2] == userLocation:
# subtract previous from current to find the number of cases that the total increased by
cases = current - previous
# if cases is higher than what is currently set as the greatest
if cases > greatest:
# set the new greatest to amount of cases
greatest = cases
# save the date of the current line
date = str(dataList[0])
# At the end print the data for the highest number of cases
print("On", date, " ", userLocation, " had the highest increase of cases with ", cases, " cases.")
myFile.close()
main()
Covid Data.txt:
First line
2020.12.04,placeholder,Miami
Test:
>>> python3 test.py
Please enter a location Texas
On None Texas had the highest increase of cases with 0 cases.
>>> python3 test.py
Please enter a location Miami
On None Miami had the highest increase of cases with 0 cases.
NOTE:
As you can see above, your logic doesn't work but the script can run. Some of conditions will be always False. For example because of this the date variable won't get value so it will be always None.

CS50 'DNA': Ways to speed up my Week 6 'dna.py' program?

So for this problem I had to create a program that takes in two arguments. A CSV database like this:
name,AGATC,AATG,TATC
Alice,2,8,3
Bob,4,1,5
Charlie,3,2,5
And a DNA sequence like this:
TAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG
My program works by first getting the "Short Tandem Repeat" (STR) headers from the database (AGATC, etc.), then counting the highest number of times each STR repeats consecutively within the sequence. Finally, it compares these counted values to the values of each row in the database, printing out a name if a match is found, or "No match" otherwise.
The program works for sure, but is ridiculously slow whenever ran using the larger database provided, to the point where the terminal pauses for an entire minute before returning any output. And unfortunately this is causing the 'check50' marking system to time-out and return a negative result upon testing with this large database.
I'm presuming the slowdown is caused by the nested loops within the 'STR_count' function:
def STR_count(sequence, seq_len, STR_array, STR_array_len):
# Creates a list to store max recurrence values for each STR
STR_count_values = [0] * STR_array_len
# Temp value to store current count of STR recurrence
temp_value = 0
# Iterates over each STR in STR_array
for i in range(STR_array_len):
STR_len = len(STR_array[i])
# Iterates over each sequence element
for j in range(seq_len):
# Ensures it's still physically possible for STR to be present in sequence
while (seq_len - j >= STR_len):
# Gets sequence substring of length STR_len, starting from jth element
sub = sequence[j:(j + (STR_len))]
# Compares current substring to current STR
if (sub == STR_array[i]):
temp_value += 1
j += STR_len
else:
# Ensures current STR_count_value is highest
if (temp_value > STR_count_values[i]):
STR_count_values[i] = temp_value
# Resets temp_value to break count, and pushes j forward by 1
temp_value = 0
j += 1
i += 1
return STR_count_values
And the 'DNA_match' function:
# Searches database file for DNA matches
def DNA_match(STR_values, arg_database, STR_array_len):
with open(arg_database, 'r') as csv_database:
database = csv.reader(csv_database)
name_array = [] * (STR_array_len + 1)
next(database)
# Iterates over one row of database at a time
for row in database:
name_array.clear()
# Copies entire row into name_array list
for column in row:
name_array.append(column)
# Converts name_array number strings to actual ints
for i in range(STR_array_len):
name_array[i + 1] = int(name_array[i + 1])
# Checks if a row's STR values match the sequence's values, prints the row name if match is found
match = 0
for i in range(0, STR_array_len, + 1):
if (name_array[i + 1] == STR_values[i]):
match += 1
if (match == STR_array_len):
print(name_array[0])
exit()
print("No match")
exit()
However, I'm new to Python, and haven't really had to consider speed before, so I'm not sure how to improve upon this.
I'm not particularly looking for people to do my work for me, so I'm happy for any suggestions to be as vague as possible. And honestly, I'll value any feedback, including stylistic advice, as I can only imagine how disgusting this code looks to those more experienced.
Here's a link to the full program, if helpful.
Thanks :) x

Thanks for providing a link to the entire program. It seems needlessly complex, but I'd say it's just a lack of knowing what features are available to you. I think you've already identified the part of your code that's causing the slowness - I haven't profiled it or anything, but my first impulse would also be the three nested loops in STR_count.
Here's how I would write it, taking advantage of the Python standard library. Every entry in the database corresponds to one person, so that's what I'm calling them. people is a list of dictionaries, where each dictionary represents one line in the database. We get this for free by using csv.DictReader.
To find the matches in the sequence, for every short tandem repeat in the database, we create a regex pattern (the current short tandem repeat, repeated one or more times). If there is a match in the sequence, the total number of repetitions is equal to the length of the match divided by the length of the current tandem repeat. For example, if AGATCAGATCAGATC is present in the sequence, and the current tandem repeat is AGATC, then the number of repetitions will be len("AGATCAGATCAGATC") // len("AGATC") which is 15 // 5, which is 3.
count is just a dictionary that maps short tandem repeats to their corresponding number of repetitions in the sequence. Finally, we search for a person whose short tandem repeat counts match those of count exactly, and print their name. If no such person exists, we print "No match".
def main():
import argparse
from csv import DictReader
import re
parser = argparse.ArgumentParser()
parser.add_argument("database_filename")
parser.add_argument("sequence_filename")
args = parser.parse_args()
with open(args.database_filename, "r") as file:
reader = DictReader(file)
short_tandem_repeats = reader.fieldnames[1:]
people = list(reader)
with open(args.sequence_filename, "r") as file:
sequence = file.read().strip()
count = dict(zip(short_tandem_repeats, [0] * len(short_tandem_repeats)))
for short_tandem_repeat in short_tandem_repeats:
pattern = f"({short_tandem_repeat}){{1,}}"
match = re.search(pattern, sequence)
if match is None:
continue
count[short_tandem_repeat] = len(match.group()) // len(short_tandem_repeat)
try:
person = next(person for person in people if all(int(person[k]) == count[k] for k in short_tandem_repeats))
print(person["name"])
except StopIteration:
print("No match")
return 0
if __name__ == "__main__":
import sys
sys.exit(main())

Python function doesnt work inside a loop

I am trying to create a code to compare gene file with gene panels.
The gene panel file is in csv format and has Chromosome, gene, start location and end locations.
patients file has chromosome, mutations and the location.
so i made a loop to pass gene panel information to a function where the comparison is done to return me a list of similar items.
the function works great when i call it with manual data. but doenst not do the comparison inside the loop.
import vcf
import os, sys
records = open('exampleGenePanel.csv')
read = vcf.Reader(open('examplePatientFile.vcf','r'))
#functions to find mutations in patients sequence
def findMutations(gn,chromo,start,end):
start = int(start)
end = int(end)
for each in read:
CHROM = each.CHROM
if CHROM != chromo:
continue
POS = each.POS
if POS < start:
continue
if POS > end:
continue
REF = each.REF
ALT = each.ALT
print (gn,CHROM,POS,REF,ALT)
list.append([gn,CHROM,POS,REF,ALT])
return list
gene = records.readlines()
list=[]
y = len (gene)
x=1
while x < 3:
field = gene[x].split(',')
gname = field[0]
chromo = field[1]
gstart = field[2]
gend = field[3]
findMutations(gname,chromo,gstart,gend)
x = x+1
if not list:
print ('Mutation not found')
else:
print (len(list),' Mutations found')
print (list)
i want to get the details of matching mutations in the list.
This works as expected when i pass the data manually to the function.
Eg.findMutations('TESTGene','chr8','146171437','146229161')
But doesnt compare when passed through the loop

The problem is that findMutations attempts to read from read each time it is called, but after the first call, read has already been read and there's nothing left. I suggest reading the contents of read once, before calling the function, then save the results in a list. Then findMutations can read the list each time it is called.
It would also be a good idea to use a name other than list for your result list, since that name conflicts with the Python built-in function. It would also be better to have findMutations return its result list rather than append it to a global.

Storing Multi-dimensional Lists?

(Code below)
I'm scraping a website and the data I'm getting back is in 2 multi-dimensional arrays. I'm wanting everything to be in a JSON format because I want to save this and load it in again later when I add "tags".
So, less vague. I'm writing a program which takes in data like what characters you have and what missions are requiring you to do (you can complete multiple at once if the attributes align), and then checks that against a list of attributes that each character fulfills and returns a sorted list of the best characters for the context.
Right now I'm only scraping character data but I've already "got" the attribute data per character - the problem there was that it wasn't sorted by name so it was just a randomly repeating list that I needed to be able to look up. I still haven't quite figured out how to do that one.
Right now I have 2 arrays, 1 for the headers of the table and one for the rows of the table. The rows contain the "Answers" for the Header's "Questions" / "Titles" ; ie Maximum Level, 50
This is true for everything but the first entry which is the Name, Pronunciation (and I just want to store the name of course).
So:
Iterations = 0
While loop based on RowArray length / 9 (While Iterations <= that)
HeaderArray[0] gives me the name
RowArray[Iterations + 1] gives me data type 2
RowArray[Iterations + 2] gives me data type 3
Repeat until Array[Iterations + 8]
Iterations +=9
So I'm going through and appending these to separate lists - single arrays like CharName[] and CharMaxLevel[] and so on.
But I'm actually not sure if that's going to make this easier or not? Because my end goal here is to send "CharacterName" and get stuff back based on that AND be able to send in "DesiredTraits" and get "CharacterNames who fit that trait" back. Which means I also need to figure out how to store that category data semi-efficiently. There's over 80 possible categories and most only fit into about 10. I don't know how I'm going to store or load that data.
I'm assuming JSON is the best way? And I'm trying to keep it all in one file for performance and code readability reasons - don't want a file for each character.
CODE: (Forgive me, I've never scraped anything before + I'm actually somewhat new to Python - just got it 4? days ago)
https://pastebin.com/yh3Z535h
^ In the event anyone wants to run this and this somehow makes it easier to grab the raw code (:
import time
import requests, bs4, re
from urllib.parse import urljoin
import json
import os
target_dir = r"D:\00Coding\Js\WebScraper" #Yes, I do know that storing this in my Javascript folder is filthy
fullname = os.path.join(target_dir,'TsumData.txt')
StartURL = 'http://disneytsumtsum.wikia.com/wiki/Skill_Upgrade_Chart'
URLPrefix = 'http://disneytsumtsum.wikia.com'
def make_soup(url):
r = requests.get(url)
soup = bs4.BeautifulSoup(r.text, 'lxml')
return soup
def get_links(url):
soup = make_soup(url)
a_tags = soup.find_all('a', href=re.compile(r"^/wiki/"))
links = [urljoin(URLPrefix, a['href'])for a in a_tags] # convert relative url to absolute url
return links
def get_tds(link):
soup = make_soup(link)
#tds = soup.find_all('li', class_="category normal") #This will give me the attributes / tags of each character
tds = soup.find_all('table', class_="wikia-infobox")
RowArray = []
HeaderArray = []
if tds:
for td in tds:
#print(td.text.strip()) #This is everything
rows = td.findChildren('tr')#[0]
headers = td.findChildren('th')#[0]
for row in rows:
cells = row.findChildren('td')
for cell in cells:
cell_content = cell.getText()
clean_content = re.sub( '\s+', ' ', cell_content).strip()
if clean_content:
RowArray.append(clean_content)
for row in rows:
cells = row.findChildren('th')
for cell in cells:
cell_content = cell.getText()
clean_content = re.sub( '\s+', ' ', cell_content).strip()
if clean_content:
HeaderArray.append(clean_content)
print(HeaderArray)
print(RowArray)
return(RowArray, HeaderArray)
#Output = json.dumps([dict(zip(RowArray, row_2)) for row_2 in HeaderArray], indent=1)
#print(json.dumps([dict(zip(RowArray, row_2)) for row_2 in HeaderArray], indent=1))
#TempFile = open(fullname, 'w') #Read only, Write Only, Append
#TempFile.write("EHLLO")
#TempFile.close()
#print(td.tbody.Series)
#print(td.tbody[Series])
#print(td.tbody["Series"])
#print(td.data-name)
#time.sleep(1)
if __name__ == '__main__':
links = get_links(StartURL)
MainHeaderArray = []
MainRowArray = []
MaxIterations = 60
Iterations = 0
for link in links: #Specifically I'll need to return and append the arrays here because they're being cleared repeatedly.
#print("Getting tds calling")
if Iterations > 38: #There are this many webpages it'll first look at that don't have the data I need
TempRA, TempHA = get_tds(link)
MainHeaderArray.append(TempHA)
MainRowArray.append(TempRA)
MaxIterations -= 1
Iterations += 1
#print(MaxIterations)
if MaxIterations <= 0: #I don't want to scrape the entire website for a prototype
break
#print("This is the end ??")
#time.sleep(3)
#jsonized = map(lambda item: {'Name':item[0], 'Series':item[1]}, zip())
print(MainHeaderArray)
#time.sleep(2.5)
#print(MainRowArray)
#time.sleep(2.5)
#print(zip())
TsumName = []
TsumSeries = []
TsumBoxType = []
TsumSkillDescription = []
TsumFullCharge = []
TsumMinScore = []
TsumScoreIncreasePerLevel = []
TsumMaxScore = []
TsumFullUpgrade = []
Iterations = 0
MaxIterations = len(MainRowArray)
while Iterations <= MaxIterations: #This will fire 1 time per Tsum
print(Iterations)
print(MainHeaderArray[Iterations][0]) #Holy this gives us Mickey ;
print(MainHeaderArray[Iterations+1][0])
print(MainHeaderArray[Iterations+2][0])
print(MainHeaderArray[Iterations+3][0])
TsumName.append(MainHeaderArray[Iterations][0])
print(MainRowArray[Iterations][1])
#At this point it will, of course, crash - that's because I only just realized I needed to append AND I just realized that everything
#Isn't stored in a list as I thought, but rather a multi-dimensional array (as you can see below I didn't know this)
TsumSeries[Iterations] = MainRowArray[Iterations+1]
TsumBoxType[Iterations] = MainRowArray[Iterations+2]
TsumSkillDescription[Iterations] = MainRowArray[Iterations+3]
TsumFullCharge[Iterations] = MainRowArray[Iterations+4]
TsumMinScore[Iterations] = MainRowArray[Iterations+5]
TsumScoreIncreasePerLevel[Iterations] = MainRowArray[Iterations+6]
TsumMaxScore[Iterations] = MainRowArray[Iterations+7]
TsumFullUpgrade[Iterations] = MainRowArray[Iterations+8]
Iterations += 9
print(Iterations)
print("It's Over")
time.sleep(3)
print(TsumName)
print(TsumSkillDescription)
Edit:
tl;dr my goal here is to be like
"For this Mission Card I need a Blue Tsum with high score potential, a Monster's Inc Tsum for a bunch of games, and a Male Tsum for a long chain.. what's the best Tsum given those?" and it'll be like "SULLY!" and automatically select it or at the very least give you a list of Tsums. Like "These ones match all of them, these ones match 2, and these match 1"
Edit 2:
Here's the command Line Output for the code above:
https://pastebin.com/vpRsX8ni
Edit 3: Alright, just got back for a short break. With some minor looking over I see what happened - my append code is saying "Append this list to the array" meaning I've got a list of lists for both the Header and Row arrays that I'm storing. So I can confirm (for myself at least) that these aren't nested lists per se but they are definitely 2 lists, each containing a single list at every entry. Definitely not a dictionary or anything "special case" at least. This should help me quickly find an answer now that I'm not throwing "multi-dimensional list" around my google searches or wondering why the list stuff isn't working (as it's expecting 1 value and gets a list instead).
Edit 4:
I need to simply add another list! But super nested.
It'll just store the categories that the Tsum has as a string.
so Array[10] = ArrayOfCategories[Tsum] (which contains every attribute in string form that the Tsum has)
So that'll be ie TsumArray[10] = ["Black", "White Gloves", "Mickey & Friends"]
And then I can just use the "Switch" that I've already made in order to check them. Possibly. Not feeling too well and haven't gotten that far yet.

Just use the with open file as json_file , write/read (super easy).
Ultimately stored 3 json files. No big deal. Much easier than appending into one big file.