Develop Reference

iter through the dict store the key value and iter again to look for similar word in dict and delete form dict eg(Light1on,Light1off) in Python

[I had problem on how to iter through dict to find a pair of similar words and output it then the delete from dict]
My intention is to generate a random output label then store it into dictionary then iter through the dictionary and store the first key in the list or some sort then iter through the dictionary to search for similar key eg Light1on and Light1off has Light1 in it and get the value for both of the key to store into a table in its respective columns.
such as
Dict = {Light1on,Light2on,Light1off...}
store value equal to Light1on the iter through the dictionary to get eg Light1 off then store its Light1on:value1 and Light1off:value2 into a table or DF with columns name: On:value1 off:value2
As I dont know how to insert the code as code i can only provide the image sry for the trouble,its my first time asking question here thx.
from collections import defaultdict
import difflib, random
olist = []
input = 10
olist1 = ['Light1on','Light2on','Fan1on','Kettle1on','Heater1on']
olist2 = ['Light2off','Kettle1off','Light1off','Fan1off','Heater1off']
events = list(range(input + 1))
for i in range(len(olist1)):
output1 = random.choice(olist1)
print(output1,'1')
olist1.remove(output1)
output2 = random.choice(olist2)
print(output2,'2')
olist2.remove(output2)
olist.append(output1)
olist.append(output2)
print(olist,'3')
outputList = {olist[i]:events[i] for i in range(10)}
print (str(outputList),'4')
# Iterating through the keys finding a pair match
for s in range(5):
for i in outputList:
if i == list(outputList)[0]:
skeys = difflib.get_close_matches(i, outputList, n=2, cutoff=0.75)
print(skeys,'5')
del outputList[skeys]
# Modified Dictionary
difflib.get_close_matches('anlmal', ['car', 'animal', 'house', 'animaltion'])
['animal']
Updated: I was unable to delete the pair of similar from the list(Dictionary) after founding par in the dictionary

You're probably getting an error about a dictionary changing size during iteration. That's because you're deleting keys from a dictionary you're iterating over, and Python doesn't like that:
d = {1:2, 3:4}
for i in d:
del d[i]
That will throw:
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
RuntimeError: dictionary changed size during iteration
To work around that, one solution is to store a list of the keys you want to delete, then delete all those keys after you've finished iterating:
keys_to_delete = []
d = {1:2, 3:4}
for i in d:
if i%2 == 1:
keys_to_delete.append(i)
for i in keys_to_delete:
del d[i]
Ta-da! Same effect, but this way avoids the error.
Also, your code above doesn't call the difflib.get_close_matches function properly. You can use print(help(difflib.get_close_matches)) to see how you are meant to call that function. You need to provide a second argument that indicates the items to which you wish to compare your first argument for possible matches.
All of that said, I have a feeling that you can accomplish your fundamental goals much more simply. If you spend a few minutes describing what you're really trying to do (this shouldn't involve any references to data types, it should just involve a description of your data and your goals), then I bet someone on this site can help you solve that problem much more simply!

python return double entry in dictionary

I am searching for hours and hours on this problem and tried everything possible but I can't get it cracked, I am quiet a dictionary noob.
I work with maya and got clashing names of lights, this happens when you duplicate a group all children are named the same as before, so having a ALL_KEY in one group results in a clashing name with a key_char in another group.
I need to identify a clashing name of the short name and return the long name so I can do a print long name is double or even a cmds.select.
Unfortunately everything I find on this matter in the internet is about returning if a list contains double values or not and only returns True or False, which is useless for me, so I tried list cleaning and list comparison, but I get stuck with a dictionary to maintain long and short names at the same time.
I managed to fetch short names if they are duplicates and return them, but on the way the long name got lost, so of course I can't identify it clearly anymore.
>import itertools
>import fnmatch
>import maya.cmds as mc
>LIGHT_TYPES = ["spotLight", "areaLight", "directionalLight", "pointLight", "aiAreaLight", "aiPhotometricLight", "aiSkyDomeLight"]
#create dict
dblList = {'long' : 'short'}
for x in mc.ls (type=LIGHT_TYPES, transforms=True):
y = x.split('|')[-1:][0]
dblList['long','short'] = dblList.setdefault(x, y)
#reverse values with keys for easier detection
rev_multidict = {}
for key, value in dblList.items():
rev_multidict.setdefault(value, set()).add(key)
#detect the doubles in the dict
#print [values for key, values in rev_multidict.items() if len(values) > 1]
flattenList = set(itertools.chain.from_iterable(values for key, values in rev_multidict.items() if len(values) > 1))
#so by now I got all the long names which clash in the scene already!
#means now I just need to make a for loop strip away the pipes and ask if the object is already in the list, then return the path with the pipe, and ask if the object is in lightlist and return the longname if so.
#but after many many hours I can't get this part working.
##as example until now print flattenList returns
>set([u'ALL_blockers|ALL_KEY', u'ABCD_0140|scSet', u'SARAH_TOPShape', u'ABCD_0140|scChars', u'ALL|ALL_KEY', u'|scChars', u'|scSet', u'|scFX', ('long', 'short'), u'ABCD_0140|scFX'])
#we see ALL_KEY is double! and that's exactly what I need returned as long name
#THIS IS THE PART THAT I CAN'T GET WORKING, CHECK IN THE LIST WHICH VALUES ARE DOUBLE IN THE LONGNAME AND RETURN THE SHORTNAME LIST.
THE WHOLE DICTIONARY IS STILL COMPLETE AS
seen = set()
uniq = []
for x in dblList2:
if x[0].split('|')[-1:][0] not in seen:
uniq.append(x.split('|')[-1:][0])
seen.add(x.split('|')[-1:][0])
thanks for your help.

I'm going to take a stab with this. If this isn't what you want let me know why.
If I have a scene with a hierarchy like this:
group1
nurbsCircle1
group2
nurbsCircle2
group3
nurbsCircle1
I can run this (adjust ls() if you need it for selection or whatnot):
conflictObjs = {}
objs = cmds.ls(shortNames = True, transforms = True)
for obj in objs:
if len( obj.split('|') ) > 1:
conflictObjs[obj] = obj.split('|')[-1]
And the output of conflictObjs will be:
# Dictionary of objects with non-unique short names
# {<long name>:<short name>}
{u'group1|nurbsCircle1': u'nurbsCircle1', u'group3|nurbsCircle1': u'nurbsCircle1'}
Showing me what objects don't have unique short names.

This will give you a list of all the lights which have duplicate short names, grouped by what the duplicated name is and including the full path of the duplicated objects:
def clashes_by_type(*types):
long_names = cmds.ls(type = types, l=True) or []
# get the parents from the lights, not using ls -type transform
long_names = set(cmds.listRelatives(*long_names, p=True, f=True) or [])
short_names = set([i.rpartition("|")[-1] for i in long_names])
short_dict = dict()
for sn in short_names:
short_dict[sn] = [i for i in long_names if i.endswith("|"+ sn)]
clashes = dict((k,v) for k, v in short_dict.items() if len(v) > 1)
return clashes
clashes_by_type('directionalLight', 'ambientLight')The main points to note:
work down from long names. short names are inherently unreliable!
when deriving the short names, include the last pipe so you don't get accidental overlaps of common names
short_names will always be a list of lists since it's created by a comprehension
once you have a dict of (name, [objects with that shortname]) it's easy to get clashes by looking for values longer than 1

Constantly getting IndexError and am unsure why in Python

I am new to python and really programming in general and am learning python through a website called rosalind.info, which is a website that aims to teach through problem solving.
Here is the problem, wherein you're asked to calculate the percentage of guanine and thymine to the string of DNA given to for each ID, then return the ID of the sample with the greatest percentage.
I'm working on the sample problem on the page and am experiencing some difficulty. I know my code is probably really inefficient and cumbersome but I take it that's to be expected for those who are new to programming.
Anyway, here is my code.
gc = open("rosalind_gcsamp.txt","r")
biz = gc.readlines()
i = 0
gcc = 0
d = {}
for i in xrange(biz.__len__()):
if biz[i].startswith(">"):
biz[i] = biz[i].replace("\n","")
biz[i+1] = biz[i+1].replace("\n","") + biz[i+2].replace("\n","")
del biz[i+2]
What I'm trying to accomplish here is, given input such as this:
>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
Break what's given into a list based on the lines and concatenate the two lines of DNA like so:
['>Rosalind_6404', 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG', 'TCCCACTAATAATTCTGAGG\n']
And delete the entry two indices after the ID, which is >Rosalind. What I do with it later I still need to figure out.
However, I keep getting an index error and can't, for the life of me, figure out why. I'm sure it's a trivial reason, I just need some help.
I've even attempted the following to limited success:
for i in xrange(biz.__len__()):
if biz[i].startswith(">"):
biz[i] = biz[i].replace("\n","")
biz[i+1] = biz[i+1].replace("\n","") + biz[i+2].replace("\n","")
elif biz[i].startswith("A" or "C" or "G" or "T") and biz[i+1].startswith(">"):
del biz[i]
which still gives me an index error but at least gives me the biz value I want.
Thanks in advance.

It is very easy do with itertools.groupby using lines that start with > as the keys and as the delimiters:
from itertools import groupby
with open("rosalind_gcsamp.txt","r") as gc:
# group elements using lines that start with ">" as the delimiter
groups = groupby(gc, key=lambda x: not x.startswith(">"))
d = {}
for k,v in groups:
# if k is False we a non match to our not x.startswith(">")
# so use the value v as the key and call next on the grouper object
# to get the next value
if not k:
key, val = list(v)[0].rstrip(), "".join(map(str.rstrip,next(groups)[1],""))
d[key] = val
print(d)
{'>Rosalind_0808': 'CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT', '>Rosalind_5959': 'CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCTATATCCATTTGTCAGCAGACACGC', '>Rosalind_6404': 'CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCCTCCCACTAATAATTCTGAGG'}
If you need order use a collections.OrderedDict in place of d.

You are looping over the length of biz. So in your last iteration biz[i+1] and biz[i+2] don't exist. There is no item after the last.

Why isn't all the data being stored?

I have a dictionary carrying key:value however it only saves the last iteration and discards the previous entries where is it being reset ?? This is the output from the ctr of iterations and the length of the dictionary
Return the complete Term and DocID Ref.
LENGTH:6960
CTR:88699
My code:
class IndexData:
def getTermDocIDCollection(self):
...............
for term in terms:
#TermDocIDCollection[term] = sourceFile['newid']
TermDocIDCollection[term] = []
TermDocIDCollection[term].append(sourceFile['newid'])
return TermDocIDCollection

The piece of code you've commented out does the following:
Sets a value to the key (removing whatever was there before, if it existed)
Sets a new value to the key (an empty list)
Appends the value set in step 1 to the new empty list
Sadly, it would do the same each iteration, so you'd end up with [last value] assigned to the key. The new code (with update) does something similar. In the old days you'd do this:
if term in TermDocIDCollection:
TermDocIDCollection[term].append(sourceFile['newid'])
else:
TermDocIDCollection[term] = [sourceFile['newid']]
or a variation of the theme using try-except. After collections was added you can do this instead:
from collections import defaultdict
# ... code...
TermDocIDCollection = defaultdict(list)
and you'd update it like this:
TermDocIDCollection[term].append(sourceFile['newid'])
no need to check if term exists in the dictionary. If it doesn't, the defaultdict type will first call to the constructor you passed (list) to create the initial value for the key

Why is python dictionary not refilling in while loop?

I've got a database that I loop through, and based on certain conditions, I send the relevant database entries to a dictionary that I created. I then want to pick one randomly from this dictionary, store it in a list, clear the dictionary, and do the whole thing again with incremented variables. FYI, the ['StartNoteNum'], etc. are just column names within the cost database.
What happens though, is that it works fine the first time thorough the loop, but if I try to clear the dictionary anywhere in the code (inside or outside the while loop), then the dictionary never re-fills based on the incremented values even though it should. To confirm that it should re-fill properly, I have set the initial values to be all possible values that it would encounter in the while loop, and each one works the first time through the loop, but fails once it tries to cycle. The error I get is that the random function can't pull from an empty dictionary. Grr... here is the code.
def compute_policy(clean_midi, cost_database):
note = 0 #Setting up starting variables.
total_score = []
current_finger = 1
path = [1]
next_move = {}
while note <= 2:
current_note = clean_midi[note] #get note-pair for scoring
dest_note = clean_midi[note+1]
for each in cost_database: #find all relevant DB entries
if (int(each['StartNoteNum']) == current_note
and int(each['DestNoteNum']) == dest_note
and int(each['StartFing']) == current_finger):
next_move[int(each['DestFing'])] = int(each['Score']) #move relevant entries to separate "bin"
policy_choice = random.choice(next_move.keys()) #choose one at random
total_score.append(next_move[policy_choice]) #track the scores for each choice in a list
path.append(policy_choice) #track the chosen finger
current_finger = policy_choice #update finger variable
note += 1
path.append(current_finger) #append last finger since the loop won't run again
return total_score, path
any help here would be much appreciated. Thanks.

You are trying to use the cost_database iterator twice. After the first time you pass through it is exhausted and thus the second time you try to use it the whole for loop is skipped because it got an empty iterator.
>>> a = xrange(4)
>>> for i in a:
... print(i)
0
1
2
3
4
>>> for i in a:
... print(i)
>>> # Nothing since 'a' is already exhausted.

One possible issue is:
int(each['DestFing']) is always the same, then the same key in the dictionary will get updated and count will stay 1.